Community Action Needed: Please respond to the NIH RFI
Transcript

usp5-201

ID
ZDB-TSCRIPT-100915-1
Name
usp5-201
Previous Names
  • usp5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010837 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010837|OTTDARG00000009453|ZDB-GENE-040426-2584 usp5|OTTDARP00000009330 usp5-001 LG_ CU467865.7 Danio rerio protein_coding KNOWN, 3324 bp
AGCGCCCCTGGCCTCGAATGAACACACTGGATCATCAGCA
GCAGCTTTTCATTGAGGGGAATCGCAGAAACAAGGGGGCT
GTCAGAGACTTCAGGAGCGGGGGCCAAAGAAAACCCAGGC
GGGCAAGTGTGCGTAGGAAAGAAGGCAATTCCTGTTGAGG
CAGAGATGACGGAGGTTAGCGAGATATTGATGTCGGTTCT
GTCCGCGATTCGGGTTCCGAGGCCCGGGGATCGTGTTCAC
AAAGACGAGTGCGCTTTCTCCTTCTCCAGCCCGGAGAGTG
AGGGGGGCTTGTATGTCTGCATGAACAGCTTTCTCGGATT
TGGGAGTAAATACGTGGACCGACACCATGCCAAAACTGGT
CAGAGAGCTTACCTGCACATCACCCGGACCCGGAAAACAC
AGAAGGAGGATGATCCCAATTCAGGATCAGGTGATCCTCC
TAAAAAGAAGCCCACAAGACTGGCCATTGGTATTGAGGGA
GGGTTCGATGTTGAGCAGGAGCAGTATGAAGAAGAGGTCA
AGGTGGTTCTTTTCCCAGACCGACAGGAAGTGACACTGGA
TGATCTCTCCTCCATGCCAGATGTTGTTCGGGAGCGGGTG
TCTCTGTCAGTGGCGGAGCTTCAGGCAGCAGACTCAGTGT
CACACACTCTGCAGGTGCAGCAGTGGGACGGAGAAGTGCG
ACAGGAGTCAAAACATGCTGCTGAACTTAAACAACTCGAC
AATGGCCTCAAAATCCCGCCAAGTGGCTGGAAGTGTGAGG
TCTGTGAGCTGCAGGAGAACCTGTGGATGAATCTGACGGA
CGGGAAAGTTTTGTGTGGCCGGAGATATTTTGATGGCTCT
GGGGGGAATAACCATGCCCTCCTGTACTACCAGCAGACTG
GATACCCACTAGCTGTTAAACTCGGCACAATAACACCTGA
CGGAGCAGATGTCTATTCATATGATGAAGATGATATGGTA
TTAGATTCTAAGCTCCCAGAACACCTTTCCCATTTTGGCA
TTGATATGATGACTATGGAAAAGACGGAGAGAACCATGAC
TGAGCTGGAGATCGCAGTTAACCAGCGTGTGGGAGAGTGG
GAGGTCATCCAGGAGTCCGGCACCACTCTGAGGCCCCTGT
GGGGTCCGGGACTCACCGGCATGAAGAACCTGGGAAACAG
CTGCTACCTCAACTCTGTCATGCAAGTGCTCTTCACCATC
CCAGACTTCCAGACCAAATACGTTTCCAACATTGACAAGA
TCTTTGATGAGGCGCCCAGTGACCCTACCCAGGACTTTAA
GACTCAAGTAGCAAAGCTGGGCTATGGCCTTTTGTCAGGA
GAGTACTCTAAACCAGCCCCAGACCCCGCAGATGAACCTA
ACACCTCTGCTGAACCCAGGGGTGACCAGGTTGGTATTGC
ACCTCGCATGTTCAAAGCTCTGGTTGGACGAGGCCACCCT
GAGTTCTCCACCAATCGGCAACAGGATGCACAAGAGTTTC
TTCTTCACTTCATAAATATGGTGGAGAGGAATTGTCGGTC
AGGCATGAATCCTTCAGAAGCTTTCAGATTCTTGGTAGAG
GAGAAGATTGTATGCCAACAATCACAAAAAGCCAAGTATA
CCCAGCGAGTTGACTATATCGTCCAGCTGCCCGTTCCCAT
GGACCAGGCAACTAATATGGATGAGCTTCAAGAAGCAGAG
CGTCGTCGTGAGGAGGCGGAGTCATCTGGAGCTCCTCCCC
CTGTTGCACCTCGTGCTCAGATCCCATTTGCTGCCTGTCT
GGCTGCTCTCAGTGAACCGGAAACACTCACAGATTTCTGG
AGCTCTGCAGTTCAGGCCAAAACCACTGCCACAAAGACCA
CTCGCTTTGCTTCATTTCCTGATCATCTTGTCATCCAAAT
CAAGAAATTCACCTTTGGGTTGGATTGGGTTCCTAAAAAA
CTAGATGTGAGCATTGACGTTCCTGAAACGCTGGATCTGA
ATGCGCTCCGTGCTATGGGACAGCAGCCAGGGGAGGAGCT
TCTGCCCGAAGTGGCCCCGCCCCCGCTCATGACCCCCGAT
GTGGAGGTTAAAGGTATCCTGGGTTCCCATGGCAACGAGG
AGGACGACTCTCTCTACTCCCCACTGCTGTCTCCAGTGTT
GGACGACTCCACAGTGTCTCAGCTGTGTGAGATGGGTTTT
CCTCTGGAGGCCTGCAGGAAGGCTGTGTATTACACAGGAA
ACACTGGCATTGATGCTGCTATGAACTGGGTGATGGGACA
CATGGATGACCCTGATTTCGCTGCACCTTTGGTGTTGCCT
GGCTCTAGTTCTGCTCCTGGCACGACACCCACAGAAAGCC
TACCTGAAGAACACCTGGCAACCATTGTTTCAATGGGATT
CAGTCGAGATCAGGCTACTCGTGCTCTCAGAGCAACGAAT
AATGTTCTGGAGCGAGCTGTGGACTGGATCTTCTCTCATC
TGGATGATCTGGAGTCCATGGATGTGTCTGAAGGAGGACG
CTCAGAGGGTGGAAGTGAGGCCAGTCGAGAGCCTCCTCCA
GGACCTCGTGTCCGTGATGGAACTGGAAAGTATGAGCTCT
TTGCATTCATCAGTCACATGGGATCGAGCACAATGTGTGG
TCATTACGTCTGCCACATCAAGAAGGACCAACAGTGGGTC
ATTTTTAACGATCAGAAAGTTTGTGCCTCTGAGAAACCAC
CGAAGGACCTGGGATACCTGTACTTTTACAGGAGAGTGGT
GGAATAAACTAGAAAATCATCTCTGTCTGTCTCATGCACG
CACACATACACATACACATGCACACACACAGTTCTGTTTC
TGGTCTAAAGGTATAGTTGGCTCCTGCTTCTGAAATGATC
CGCAGTTTAAGTCAAAGCACTTCTCCATCTGATATATTCA
CTATTGAGAGACAGCTCACACAGGGGAAGGAAAAAAAAAT
CAAATGTAGGATGTGCGGGTTAGAGTGTTCTTACTCAAAA
CGCCCATGCTGTGCAGCGCCTTACCACACACACACACACA
CAAACACAAGACAGTAGTCTCCTTCGTGCCTCCCCCTGAT
TGGATAGTGGCTTTTGTGACATCACCGCTTCTAGAGCTAA
GCTCCACCTTCCTTTATGTGTTCCAGAATGTTTCTGCAAA
TGTTTAATGGCAAGTAAATATCACTAAATCACACTCAAAT
AACTGCTAAATATTATGTATTGGAGTTTTAAATTTAAAAT
AATAATAAATGCAAAAGGTATCGTGCGGTTTCACTTTCCT
TATGTTTTGTTCTCCTTTTTTGGGGGGAGGAAAGAATCAT
TTTGTTCATTTTGCTTTAAAATAAAAAAACGTGTCTCTTT
GCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations