ZFIN ID: ZDB-TSCRIPT-110325-1678
Transcript Name: cyp26b1-201
Previous Name: cyp26b1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050573 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050573|OTTDARG00000035532|ZDB-GENE-030131-2908 cyp26b1|OTTDARP00000039707 cyp26b1-001 LG_none CU464085.9,CU467874.3 Danio rerio protein_coding NOVEL, 3869 bp
CGACTCGAACTCACATTAAGAAACTGTATGTGAAGAGAGA
GAGAGAAATAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGA
GAGCTGGAGCGCAAGAGAGAGGTAGAGAGTGAAACCGCAT
CAGAAAACGGGCTAGCGAGACGCACTACAGTCATCTGAAG
ATTTTTACTGCTCATAGGCATCAAACTTCGGAGGATTATT
TCTTTCATTTATTTCTTCGTCTTCCATATGACCATTACTT
GATTTCAGTGTATTTAAAGAGTTTATATCGAGCTTTAAGA
TTATATATAGGCCTATTTAAAAATTATAACTAAAACAATT
TATTTTATATTTTCAAAAAGTAACTTAAAACTTTTTCTTG
ATTACTTATATTTGCCTTTTTTACTTTTGAAATTTAAAAC
AACGAATCAATCTCAAGTTGGACAAGTTCACTCCAAATTT
ACACTTCAAAAATTTGAATTTAATTGATGAATTCAAGAAA
TATTGGTCACCGATTTGGATGATTTAAAATGATATACACA
CATTTAAGATCGATTTGTTATATCCAGCATTCTGTTAATT
AAATAGCCGACTATATTTTATTTATTCATTTACTCTACAT
AAACTTTTAGGGTTGGATTTGTGCTTTTTCGAATAATTGT
CGCAGAGAGTCATATCTAACAGAGTAGGTCACTCTCCTAA
TTTTAGGTTTAACCACTTTATTGCTCATCACTCCAAAGAG
ATATTTGAGACAAGTCCCCGGACGTTCACAGCCATGCTCT
TCGAGAGTTTTGACCTTGTCTCGGCGTTGGCGACGCTGGC
TGCGTGTTTAGTGTCCATGGCACTTCTTCTGGCCGTGTCC
CAGCAGCTCTGGCAGCTGAGGTGGACCGCAACACGGGACA
AGAGCTGCAAGCTGCCCATGCCCAAGGGCTCCATGGGGTT
CCCCATCATCGGAGAAACATGCCACTGGTTCTTTCAGGGT
GCAGGTTTCCATGCATCCAGAAGACAGAAGTATGGGAATG
TATTCAAGACTCATCTACTGGGACGGCCGCTGATCCGGGT
CACTGGGGCAGAGAATGTGCGTAAGGTTCTTATGGGAGAG
CACAGCCTGGTCACTGTGGACTGGCCCCAAAGCACCAGCA
CTCTTCTGGGGCCAAACAGTTTGGCCAACTCAATAGGAGA
CATCCATCGCAAAAGGAGGAAGATCTTTGCTAAAGTTTTT
AGCCATGAGGCTCTGGAAAGCTACCTGCCCAAGATCCAGC
AGGTCATTCAGGAGACCCTACGTGTGTGGAGCTCCAATCC
TGACCCCATCAATGTGTATCGCGAGTCCCAGCGGCTATCA
TTCAACATGGCAGTACGCGTGCTCCTGGGTTTCCGCATCC
CAGAAGAAGAGATGCACTGTTTGTTCAGCACCTTCCAGGA
GTTTGTGGAGAACGTCTTCAGTCTTCCCATCGACCTGCCA
TTTAGTGGTTACAGAAAGGGTATTCGAGCAAGAGACTCAC
TCCAAAAAAGCATAGAGAAAGCCATCAGAGAGAAACCACT
CCACACACAGGGGAAAGATTACACTGATGCTCTTGATGTG
CTTCTAGAAAGCGCCAAGGAGAACAACACGGAGCTTACAA
TGCAGGAGCTCAAGGAGTCCACTATTGAGCTGATTTTTGC
AGCGTTTGCCACTACAGCCAGCGCCAGCACGTCTCTGGTG
ATGCAGCTGCTGCGTCACCCTGCGGTGCTGGAGAAGCTGC
GTGAAGAGCTGCGGAGCTGTGGTCTTCTTCATGACGGCTG
TCTGTGTCAGGGGGAGCTGCGGTTGGACAGCATCATCAGC
CTAAAGTACCTGGACTGTGTCATTAAAGAGGTCCTACGTC
TCTTCGCCCCAGTGTCAGGAGGATACAGAATAGCCACTCA
AACCTTTGAGCTGGATGGAGTCCAGGTTCCTAAAGGCTGG
AGTGTGATGTACAGTATCCGCGACACCCATGACACCTCGG
CTGTGTTCAAGGACGTCGAGGCCTTTGACCCAGATCGATT
CAGCCCCGAGCGCAGCGAGGACCGCGAGGGCCGCTTTCAC
TACCTGCCCTTTGGTGGTGGCGTTCGTTCCTGCCTTGGTA
AACAGCTGGCCACTCTTTTCCTCAAACTGCTGGCTGTGGA
GCTCGCTGGAGGCAGCCGGTTTGAGCTGTCAACCAGAACA
TTCCCACGAATGATCTCTGTCCCTGTGGTCCATCCGACCG
ACGGCCTCCGCGTCAAATTCTTCGGCCTCGACTCCAATCA
GAACCAGATCATGGCAAAGTCGGATGAAATGCTTGACGCC
ACTGTGTGACAAACTCGAGCTGAAGCTTCCGAAAAAAAAA
AAGACTCTCGTTTTGCCAAAAATGTATAGTCTATCATTTG
TAAAGAAGTATATCAAAATTATATATATGAACGTATCGCT
ACATCAGGAGAGCACAAGAGGAAGGTTTCCGGAAAGAGGT
TAAAAGGACAGTTTTATAAGTCACAGGGTATGGCCAGCGC
AGGACGGCTCTGGACGAATCAGTCTTGAAATTGTTTTTGA
GTGTGAGTGTTTGGATGGTGAGTTCATTTATGTGTATATA
CAGTACGTGTTTGTGTGTAAATATGTGTGTGTGTGTGCCT
GTTTGCGTGCGTGGACAGGTTGTTACTCAGCTAAGATATT
AGGAGTCGGAGTAGGCAGTGTAAACTAGAATGAATGGGAG
GATTGTGTAATTTACTCAGGTGTGTGTTTGCAGTACAGAA
GGAGCTTTCATACTAACCCAGTACCTGTTATACACGCTCT
GTACATAAGTGACAATTCATAATATTCTGGCTAAGAGAGC
ATGAAAAGGGGATGAAGAAAGACATATATAAAAGGAGAAT
ATGAGAAGGAATGATCTTGTGCGGGCTCTCAAAAACAAGC
TATAGAGGGAATGAGGGACTTGTTCCTGCTGCAGATTTTA
TATCGGAAGACATTTATGAAAAAAAGAAAAAAAAACAAAA
AACAAGTCGTATATGCTGCTTTGGGAGCCGCTTTTTATTT
ATATGATGGAGCAGAGTGCAAAGAGGAAGGCTTCTTTTTT
TCTCCTGCTGCTCCATTTCGATATAAGAAGAAATGCGATG
ATGAAACTCATCAGTTATTAACTCTATATATATATATATA
TTAGAAGATGAGATGCCTCTGAAAGGACTTGAAAGTTTGA
GAGGCAATGGGACTCAATCCTCCATCACTTCCTCTAACAG
AAGGACTTTTCTTTTTATAAAATATGCCACTGATCTTTTT
TTATGAATTAAAATAATGTCTGCTGCTTTCAGTGTACCGT
TTTCTAACAGAGACTAAATCGCCACCTTCAGCTACGGTTT
TTGCTGTTTCTAAGCAAGTGGAATTTCACTATTAGAAAGC
CATGGGTAAAGCATATTTGCATCGTCTAATATCCTAATAT
CCTTGCTATTAATATTATTGTAATAAATCTTATTTTAAGT
GCTATTTTTGTTATATTTCAGAATAGAGTTCTAGTATAAG
TCAAGTCTGTTGGTAAATACTGTTCTATTTAGAATGATAT
GGATTTCAGTTATACTGTATTGTACACAGTGTTTAAATGT
TAATATGGTTTTATCTTATTGTAATAATTATAATTTTCTT
TTGTTTATCATTATTATCATTGCATTTAGTTCTTATTAAT
AAACAGAAGCACTTGCGAGGTATGTTTATTTTGAGTGCCA
TTTGACTACATGTTCTGTTCTTTTGTCGATTGTTGCGTTT
GTCTGTACATATATTTTATTCCTTTTTACAAGCCCACATT
TCACTTAGTTCAAATATGAATGTTTTTTTTCCTCTCTTTT
TTTGTTACAGTGATTCTTAAATGTACTTGGTAATTTTATA
AACCCTTGTAATAAACTATAATGTGAAAA

cyp26b1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cyp26b1-201 3869
ncRNA cyp26b1-002 (1)    Ensembl 579
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp26b1-201 Contained in:
[BAC] CH73-51F7 (1), CH73-368P22 (1)

Genome Resources: Vega_Trans:OTTDART00000050573 (1),  Ensembl_Trans:ENSDART00000110347 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC066759 (1) 3348 nt
GenBank:AY321366 (1) 2939 nt
GenBank:EE111284 (1) 2519 nt
GenBank:BI709183 (1) 530 nt
CITATIONS (2)