header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2586
Transcript Name: cyp26b1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050574 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050574|OTTDARG00000035532|ZDB-GENE-030131-2908 cyp26b1|no_translation cyp26b1-002 LG_none CU464085.9,CU467874.3 Danio rerio protein_coding NOVEL, 579 bp
CCCTCAGGAGTCCACTATTGAGCTGATTTTTGCAGCGTTT
GCCACTACAGCCAGCGCCAGCACGTCTCTGGTGATGCAGC
TGCTGCGTCACCCTGCGGTGCTGGAGAAGCTGCGTGAAGA
GCTGCGGAGCTGTGGTCTTCTTCATGACGGCTGTCTGTGT
CAGGGGGAGCTGCGGTTGGACAGCATCATCAGCCTAAAGT
ACCTGGACTGTGTCATTAAAGAGGTCCTACGTCTCTTCGC
CCCAGTGTCAGGAGGATACAGAATAGCCACTCAAACCTTT
GAGCTGGATGGAGTCCAGGTTCCTAAAGGCTGGAGTGTGA
TGTACAGTATCCGCGACACCCATGACACCTCGGCTGTGTT
CAAGGACGTCGAGGCCTTTGACCCAGATCGATTCAGCCCC
GAGCGCAGCGAGGACCGCGAGGGCCGCTTTCACTACCTGC
CCTTTGGTGGTGGCGTTCGTTCCTGCCTTGGTAAACAGCT
GGCCACTCTTTTCCTCAAACTGCTGGCTGTGGAGCTCGCT
GGAGGCAGCCGGTTTGAGCTGTCAACCAGAACATTCCCAC
GAATGATCTCTGTCCCTGT

cyp26b1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyp26b1-002 579
mRNA cyp26b1-201 (1) 3869
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp26b1-002 Contained in:

OTHER cyp26b1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050574 (1)
  • Ensembl_Trans:ENSDART00000150180 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FP114615 (1) 618 bp
    CITATIONS (2)