Transcript

acy1-003

ID
ZDB-TSCRIPT-110325-1330
Name
acy1-003
Previous Names
  • zfos-226g1.1-003
  • zgc:55605-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049141 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049141|OTTDARG00000032936|ZDB-GENE-040426-755 acy1|no_translation ZFOS-226G1.1-003 LG_ CU896698.6 Danio rerio protein_coding KNOWN, 846 bp
GGCGTATCAAAGCGTGTCGCTACTGATCTGAAGTCAGCCG
TGAGCTTGAGCTGAAGCAGGACAGTGGTGCGGGATGCTGC
CTGATAAAGATGGACTGAATGGAGGTGGAGGAGTGCAGGA
CGGTCACCCAGCTGAAGACCCTTCAGTGACTCTGTTCAGA
GAATACCTGCGCCTGAAGACCGTCCATCCAGAGCCAGACT
ACGATGCTGCTCTGAAGTTCCTGGAGCGGATGGCAGAGGA
GCTCGCTTTACCCATGAAGAAAGTGGAGGTGTGTCCCGGT
CGAGTGGTTGCCATCATCTCCTGGATCGGCTCCAGGCCGG
AGCTCAAGTCTGTGGTGCTGAACTCACACACTGATGTGGT
TCCTGTGTATGAGGTAAAGCTGAAACACATCCGTCTCTGC
ACTGATTAACAACACGTCACATCACTGTCTGTGCGTCTGC
TGCAGGAGCACTGGAAACATCATCCATTCGCTGCTGTGAA
AGATGCGGACGGCAACATCTACGCCAGAGGAGCTCAGGAC
ATGAAATCCGTCACCATACAGTACATTGAAGCCATTCGCA
GACTGAAGGCGGCCGGGAAGAGATTTTCTCGAACCATCCA
CTTAACATTTGTCCCAGACGAGGAGGTCGGCGGTCACAAA
GGAATGGAGACGTTTGTGAAGCACCCAGAATTTCAGAAGT
TGAACATGGGTTTTGCTCTTGATGAAGGATTGGCAAACCC
CACCAATGCCTACACTGTATTCTATGGAGAAAGAAACCCC
TGGTGGATCACCGTTCGCTGTCCTGGAAGTCCAGGTCATG
GTTCCAGGTTTGTGGAAAACACAGCAGCAGAGAAATTAGT
GAGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations