Transcript

acy1-201

ID
ZDB-TSCRIPT-100915-704
Name
acy1-201
Previous Names
  • acy1-001
  • zfos-226g1.1-001
  • zgc:55605-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046130 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046130|OTTDARG00000032936|ZDB-GENE-040426-755 acy1|OTTDARP00000036418 ZFOS-226G1.1-001 LG_ CU896698.6 Danio rerio protein_coding KNOWN, 2494 bp
CGCAGAACCGGAGCGCTCGTGTTTTTTGGCATGATCGAGC
ATAATAAGTAACATCCCGAGTTCAGCCGAGTGGCCCTGGA
GCGAAGGACAGTGGTGCGGGATGCTGCCTGATAAAGATGG
ACTGAATGGAGGTGGAGGAGTGCAGGACGGTCACCCAGCT
GAAGACCCTTCAGTGACTCTGTTCAGAGAATACCTGCGCC
TGAAGACCGTCCATCCAGAGCCAGACTACGATGCTGCTCT
GAAGTTCCTGGAGCGGATGGCAGAGGAGCTCGCTTTACCC
ATGAAGAAAGTGGAGGTGTGTCCCGGTCGAGTGGTTGCCA
TCATCTCCTGGATCGGCTCCAGGCCGGAGCTCAAGTCTGT
GGTGCTGAACTCACACACTGATGTGGTTCCTGTGTATGAG
GAGCACTGGAAACATCATCCATTCGCTGCTGTGAAAGATG
CGGACGGCAACATCTACGCCAGAGGAGCTCAGGACATGAA
ATCCGTCACCATACAGTACATTGAAGCCATTCGCAGACTG
AAGGCGGCCGGGAAGAGATTTTCTCGAACCATCCACTTAA
CATTTGTCCCAGACGAGGAGGTCGGCGGTCACAAAGGAAT
GGAGACGTTTGTGAAGCACCCAGAATTTCAGAAGTTGAAC
ATGGGTTTTGCTCTTGATGAAGGATTGGCAAACCCCACCA
ATGCCTACACTGTATTCTATGGAGAAAGAAACCCCTGGTG
GATCACCGTTCGCTGTCCTGGAAGTCCAGGTCATGGTTCC
AGGTTTGTGGAAAACACAGCAGCAGAGAAATTACGGCGAG
TTATAAACTCCTTCCTGGAGTTCAGAGAGAAAGAGAAACA
GCGACTGAACACCAGTGAGTGTTTTACTCTGGGAGACGTC
ACCACTATTAACATGACCATGGTCAAAGGAGGCGTCGCTT
ATAATGTGGTTCCTGCAGAAATGGACGTCAGCTTTGACTT
GAGAATCCCTCCTACTGTTAACCTGCAGGAGTTTGAGGAA
AAGATTAAAGTCTGGTGTCGAGAAGCCGGTGAAGACGTGA
CTTATGACTTTGCACAGAAACACATGGACCAGAACTTGAC
CTCCACGGATGAAAATGACCCCTGGTGGCAAGCCTTCAGC
TCCACATGTAAAGCAATGAACATGACTCTGAAAAAGGAAA
TCTTCCCTGCTGCCACGGACAGCCGGTTCATTCGGGAAGT
GGGTCTTCCTGCCATTGGTTTCTCTCCAATGAATCTCACC
CCCATCCTGCTTCACGATCACAACGAGTACCTGAACGAGC
AGGTGTTTCTGCAGGGCATCCAGGTGTACGAACGCCTCAT
TCCTGCTCTCGCCGGTGTGGCTCCGCTGAGCGCAGAGCTG
TAGATTCACTCTGCATCCGAAATAGCTCCTCATACCGTTA
AACAGTGCACTATTTGACAGAGCAGCCATTTCTTGTGGTG
TTTGAAATCATAGTGGACACTCTGAAGTGCACTCAATCAA
TCCCACAATGCAACACAACAACAAGTGTACATCCCACGTG
CACTCAACAGTTAGAAAGTACTCGTAAATGCCATGTAAGA
GTTCAGCACTCATGAATTTCCGCATCCAACCACAAGAAGG
CGTTCACAGCAGAATCATATCAGTGTACACTTCAAAATAA
AATATATATTTAATTAAAGTAATGTACACATGACAGAAAT
CAACGTACTTAGTTTCATTTCTAGTAGACCACTAAGGGTC
AAATAATTATCACAGGGTCTGACCTGAAATTAAAAATTGT
ATCCATCTGAGGCGTTTAAAACTAAACGGCATCCCTTCAG
TGCACTCCACATTGCTCACTCAATTTCATTCACTCTTTTG
AGTGGACTATATTAGTAGACTCATGTAGGGAATAGTAAAT
GAGGGTATAGGGGGCGATTTCAGATACAGCATCAGTCTTT
CTGTTCATCTCTCTAAGCTTGCCGACTGAAATACGGTGCT
GATTTTCACTCATATCGAGAATCGTATCTGCCATAACACC
AAAGATTGAGCTGATCCCATATAACCGAGATCATCATTTT
GCGTTCGCTTTAACTCAGGAGTCCCTGTCTTTCAATAATG
TCTTAGAGATGCTTTGAAGTCTTATTTGTCTGCTGGCATT
TACAGTTAGAAGCTGCTGTAAACCATTTTAATTCATGAAG
TTTGTAAATTTAACACACCGAAGTAAGGTGGCCTGTGTCT
CATATGAGAAATGAAAATGTTTTCAGAGACTCAAACGGTG
TAGCTGTGCTTGCCATATATGCATTATATTTTTAATACAG
ATGATTTTGATGCAAATGTATGGGTATATACTGAATATAT
GTATGGGTCATGTATAATAAGACTTATACTATACTGTATT
ATACCACACAGTTAGACTGAATCACACCTCGTGATTTCAA
GAGTTATGAATTTTGAAGTTACCTCAAACTGGTGCTACTT
TGCCTTCCTGATTAAATAATTAAAAGGGTACCATATACAT
CAATGCTGTCAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations