Transcript

acy1-002

ID
ZDB-TSCRIPT-100915-1220
Name
acy1-002
Previous Names
  • zfos-226g1.1-002
  • zgc:55605-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046131 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046131|OTTDARG00000032936|ZDB-GENE-040426-755 acy1|no_translation ZFOS-226G1.1-002 LG_ CU896698.6 Danio rerio protein_coding KNOWN, 508 bp
GGGAGATTCGCATCATGCTATCATGTCAATACGGAGCAAA
AACTCTTGAGGAATATTTCCAGTAGCTTGTTGAAACTATG
CCACGAAGGATTAAGGCAGTTCTGAAGGCAAAAGGGGGTC
CAAGCCGGTACTAGTAAGGTGTACCTAATAAAGTGGCCGA
CAGTGGTGCGGGATGCTGCCTGATAAAGATGGACTGAATG
GAGGTGGAGGAGTGCAGGACGGTCACCCAGCTGAAGACCC
TTCAGTGACTCTGTTCAGAGAATACCTGCGCCTGAAGACC
GTCCATCCAGAGCCAGACTACGATGCTGCTCTGAAGTTCC
TGGAGCGGATGGCAGAGGAGCTCGCTTTACCCATGAAGAA
AGTGGAGGTGTGTCCCGGTCGAGTGGTTGCCATCATCTCC
TGGATCGGCTCCAGGCCGGAGCTCAAGTCTGTGGTGCTGA
ACTCACACACTGATGTGGTTCCTGTGTATGAGGTAAAGCT
GAAACACATCCGTCTCTGCACTGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations