ZFIN ID: ZDB-TSCRIPT-100915-864
Transcript Name: txnrd2.2-202
Previous Names: ch1073-179p4.3-001, si:ch1073-179p4.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046784 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046784|OTTDARG00000033297|ZDB-GENE-040914-66 si:ch1073-179p4.3|OTTDARP00000036855 CH1073-179P4.3-001 LG_ CU651631.8 Danio rerio protein_coding NOVEL, 1179 bp
GATCCGATTCAAATGAAAAAGAATCTGACGCCGCTTACGT
CGTACAGTCAGCTGAGGAGAACAAAATTAACACTTTATAA
AGGGCTTTTTATTCTGTACTCGTTATTGTAGACGGCAAAC
ATGCTAACCTATCTGTTAAGCTAGGTCATAGCAGATACGA
CGTTGTAAAATTTGTAACGGATGGTGAAACGTTCAGCCAG
GCTTCTTTTGGGGCACCTATAACTCTGACAGGGGTCTTAT
CTTGTCGACAGTATGGCTGCCTTCAGTAGAGGCAGGCAGA
GGGTGAAAACTCTCTGCTGTTTCAGGACTTTAATACTTTC
AAGAAACTTTACAGCAGGTAAATTTGATTATGATTTGGTG
GTTATTGGTGGAGGCTCTGGAGGGTTGGCATGTTCAAAAG
AAGCTGCCCAGTTAGGACAGAAAGTTGCTGTCTTGGACTA
TGTTGAACCTTCACTCAAAGGCACAAAGTGGGGTCTCGGT
GGCACGTGTGTGAATGTCGGCTGTATTCCAAAGAAGCTTA
TGCATCAGGCAGCACTGCTTGGCACTGCTGTCAAAGATGC
TAGGAAGTATGGCTGGCAAATCCCAGAAACCCTGTCACAT
GACTGGCCAACAATGGCTGAGGCTGTCCAGAACCATGTTA
GGTCTCTAAACTGGGGTCACAGAGTTCAACTACAAGACAA
GAAGGTGAAATATTTAAATATGAAGGGCACTCTGCTGGAT
AAACACACTGTCAGAGCTGTAAATGCCCAAGGGAAGGAGA
TGACAGTGACCGCCAGAAACATTCTGTTAGCTACTGGTGG
ACGGCCAAAGTACCCTACACATGTCCCAGGTGCCATGGAG
TTTGGGATCACAAGTGATGATATTTTCTGGCTCAAAGAGT
CTCCCAAAAAAACGTTGATCATTGGTGCAAGCTATGTATC
GCTGGAGTGTGCTGGTTTTCTTACAGGCATTGGGCTGGAC
ACCAGTGTAATGGTGCGCAGTATCGCCCTCCGCGGGTTTG
ATCAGCAAATGTCTGGTTTAGTCACAGACTACATGGAGAC
GTATGGCACGAAGTTCCACTGGAAGTGCACACCGAAAAGT
GTAGAAAAGCTGCCATCTGGCCATCTTCAAGTCACATGGA
TGGATTTAAACACCAAAGAGGAACATCAAGACACATTCAA
CTCAGTACTTTGGGCTGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
txnrd2.2-202 Contained in:
[Fosmid] CH1073-179P4 (1) (order this)
OTHER txnrd2.2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046784 (1)
  • Ensembl_Trans:ENSDART00000133455 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV754589 (1) 894bp
    GenBank:EH487695 (1) 842bp
    CITATIONS (2)