ZFIN ID: ZDB-TSCRIPT-090929-20161
Transcript Name: txnrd2.1-201
Previous Name: txnrd2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039920 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039920|OTTDARG00000029141|ZDB-GENE-081104-217 txnrd2|OTTDARP00000031914 CH211-275N24.1-001 LG_ CR847528.16 Danio rerio protein_coding NOVEL, 620 bp
GCAGAGCCCCTGAAACCAAGACTCTTAATTTGGAAAAGGT
TGGCGTGAAGATCAACAAAGAAACAGGAAAGATAATCGTG
GCTGCTGACGAAGCCACGTCTGTGCCGAATATTTTTGCTA
TTGGAGACATCGGTGAGGGTCGTCCTGAGTTGACCCCCAC
CGCCATTAAGGCTGGAAAACTCCTGGCCCACAGACTGGCT
GGTCGTTCCACTGAGCTCATGAATTACGAGAATGTAGCTA
CTACAGTGTTCACACCACTAGAATATGGCTGTGTAGGTCT
GTCTGAAGAAGAGGCAGAAAGGAGACATGGAAAAGACCAG
ATTGAGGTGTACCATGCTTTCTACAAACCGCTGGAGTTCA
CTGTGGCTGAGAGAGATGCCACTCAATGCTATATAAAGGT
GGTTTGTCTACGAGAAGGTGACCAGCGCGTGCTGGGTCTG
CATTTTACTGGGCCGAACGCTGGTGAAGTCACACAGGGCT
TTGCTTTGGGCTTCCAGTGTGGACTTACATACGAACACCT
CAGGAACACAGTGGGGATTCACCCCACCTGTGCTGAGGAG
CTCACCAAACTCAACATCACCAAACGCTCGGGTCTTGACG
CCACGGTGACAGGCTGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
txnrd2.1-201 Contained in:
[BAC] CH211-275N24 (1)

Genome Resources: Vega_Trans:OTTDART00000039920 (1),  Ensembl_Trans:ENSDART00000139203 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)