Transcript

plecb-003

ID
ZDB-TSCRIPT-100915-780
Name
plecb-003
Previous Names
  • ch211-24c14.1-003
  • si:ch211-24c14.1-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046431 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046431|OTTDARG00000033100|ZDB-GENE-100917-2 plecb|no_translation CH211-24C14.1-003 LG_none AL929535.7,CT574574.16,CR848788.7 Danio rerio protein_coding NOVEL, 536 bp
GGCAAAAATAAGAGGAGCGCCACGAAGACTAACAAACCCG
GACTCTTTCTTTCACTTCTTCATCGTCACTTTTTTACTCA
GCTCATCCGCTTTTGGCTGCTCCCAAAACTTCATGAAGAT
CATACCTGATGAACGGGACAGAGTGCAGAAGAAGACTTTC
ACAAAATGGGTGAACAAACACCTAATAAAGCACTGGAGGT
CTGAGACTCAGCGTCACGTGAATGACCTGTACGAAGATCT
CCGAGATGGACATAACCTGATCTCCCTCCTGGAGGTCCTC
TCTGGAGAGACGCTGCCTCGTGAGAGAGGACGCATGCGAT
TCCACAAACTGCAGAATGTGCAGATAGCACTGGATTTCCT
CAGACACCGGCAGGTCAAGCTGGTAAACATCAGGAATGAC
GACATCGCTGACGGAAACCCAAAGCTGACCCTGGGTCTGA
TCTGGACCATCATCCTCCACTTCCAGATTTCAGATATCCA
GGTGAACGGTCAGTCAGATGACATGTCAGCCAAGGAGAAG
CTGCTCTTCTGGTCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations