Community Action Needed: Please respond to the NIH RFI
Transcript

plecb-002

ID
ZDB-TSCRIPT-100915-266
Name
plecb-002
Previous Names
  • ch211-24c14.1-002
  • si:ch211-24c14.1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046430 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046430|OTTDARG00000033100|ZDB-GENE-100917-2 plecb|no_translation CH211-24C14.1-002 LG_none AL929535.7,CT574574.16,CR848788.7 Danio rerio protein_coding NOVEL, 698 bp
CTCTCTCTCATACAGTGGTGCTCATCCTTTACCGGCTCAC
ACACACACACAGACTGATGGCCATGTACGAGCCCTTCTGC
CTGCCACCCAACGCAGACGAGCAGGACTTCATTCAAGCCT
ACGAGAACGTCAGAGAGAAATATAAAGATGAACGGGACAG
AGTGCAGAAGAAGACTTTCACAAAATGGGTGAACAAACAC
CTAATAAAGACTCAGCGTCACGTGAATGACCTGTACGAAG
ATCTCCGAGATGGACATAACCTGATCTCCCTCCTGGAGGT
CCTCTCTGGAGAGACGCTGCCTCGTGAGAGAGGACGCATG
CGATTCCACAAACTGCAGAATGTGCAGATAGCACTGGATT
TCCTCAGACACCGGCAGGTCAAGCTGGTAAACATCAGGAA
TGACGACATCGCTGACGGAAACCCAAAGCTGACCCTGGGT
CTGATCTGGACCATCATCCTCCACTTCCAGGTCTCCTATT
CTATTTCAGATATCCAGGTGAACGGTCAGTCAGATGACAT
GTCAGCCAAGGAGAAGCTGCTCTTCTGGTCCCAGCGGATG
GTGGATGGATATCACGGTATCCGCTGCGATAACTTCACCA
CCAGCTGGAGAGACGGAAAACTCTTTAACGCCATCATACA
CAAACACGAACCCAGGCTTATCGACATGCCAAAGGTTTAT
CGCCAGACCAACATGGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations