Transcript

ubqln4-201

ID
ZDB-TSCRIPT-100915-755
Name
ubqln4-201
Previous Names
  • ubin-001
  • ubqln4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046323 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046323|OTTDARG00000033038|ZDB-GENE-030131-6269 ubqln4|OTTDARP00000036546 ubin-001 LG_ BX323793.10 Danio rerio protein_coding KNOWN, 3328 bp
GTGAATTCGCGGACACGCCACACCACTAGAGGCCGCTGTG
GAACAACCGGCGTTTGCAGCACTTTTCTCCGCTGCTTGTT
GGTGCGATGATGTAATGAAGTAAAAGAAGAGTAAAGATGG
CGGAGAATAGCGGCACGGATCCTGCCGTGGAGACGAACAC
TGAAGAAAATGCCGCCGCTAGCGCGACTATCATTAAGGTT
ACCGTCAAAACACCGAAGGATAAAGAAGAAATAGCCATCG
CCGAGGACGCATCTGTCGCACAATTTAAAGAGGAAATCTC
CAAAAGATTTAAGGCGAAGCAAGACCAGTTGGTTTTGATT
TTTGCTGGTAAGATCCTGAAAGATGGAGACACTCTCGGTC
AGCATGGCATTAAAGACGGACTTACGGTTCACCTGGTCAT
CAAAACAGCACAAAAGACTTCGGGTGCTGGTAGTTCGCAG
ACCTCTGCCTCTTCTGGCCCTGGACCATCACAGGGCAGCC
CCTCTGGAACCGATACCCCTAGCCCGGCTGGTAACCTGGG
CACACCACAGGGCAGCGGGCCCTCCCCTACCCCATCACAG
CCAGCCAATATACTAGCTGGATTTGGTGACCTCTCAGGTC
TCTCTAATCTTGGTATGGGATCTGCCAACTTCATGGAGCT
TCAGCAACAGATGCAGCGACAGCTCATGTCCAACCCGGAG
ATGCTGTCTCAGATCATGGAGAATCCACTTGTGCAGAGCA
TGATGTCCAACCCTGACTTGATGAGGCAGATGATCATGGC
TAATCCACAGATGCAGCAGCTGATGGAGCGCAACCCCGAG
ATTTCACACATGCTTAATAACCCCGAGCTCATGAGACAGA
CAATGGAGTTGGCACGGAACCCAGCTATGATGCAAGAGAT
GATGCGTAACCAGGACAGGGCGCTTAGCAACCTAGAGAGT
ATTCCCGGAGGATATAATGCTCTCCGGAGGATGTACACAG
ACATTCAAGAGCCCATGTTTAGTGCTGCACGTGAACAGTT
TGGAAATAACCCCTTCTCAGCATTGGGTGGAAATGGTGAA
AACCCCGGAACGCAGCCCTCCAGGACAGAAAACAGAGAGC
CTCTGCCAAACCCCTGGGGGCCTCCTGACGGCACCGCTTC
CACCACCTCCTCTGGGACGCCCACCACCACCAGCTCCACC
ACAAGCTCAACCACACCCAGCGTGTCCAATCCTCTGGGCA
TTAGCTCCTCTAACCTTGGAAACGGTATGTTTAACAGTCC
TGGCATGCAAAGCCTAATGCAACAGATCTCGGAGAACCCT
CAGCTTATGCAGAACATGATTTCTGCTCCTTATATGCGCA
CCATGATGCAATCCCTGGCCCAGAATCCTGATGTTGCCTC
ACAGGTATTGATGAACAACCCTCTCTTTGCGGGAAATCCA
CAACTGCAAGAGCAGATGAGACAGCAGCTACCTGTATTTC
TACAGCAGATGCAGAACCCAGAAGCCCTTTCTGTCATGAC
AAATCCTCGAGCCATGAGAGCCCTAATGCAGATCCAGGAG
GGACTGCAAACCCTTCAAACTGAAGCCCCTGGACTTATGC
CCGGTCTGGGGCCTGGAGGAATGCCTGGTGGGATTCCCGT
TGGTATGCCTGGTGCCCCACTGCCCACAGGAGTGACTGTG
ACACCTGAGAATCCTCCGCCTTCCAGCCAGGGCTCCACCC
CAACCCCGACTGCTGGAGCCAGTCCTGCCCAGCAGCAGCT
CATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGCGCA
TCGACTCAGACTCCAGAAGTGCGTTTCCAGCAACAGCTGG
AGCAGCTGAGTGCCATGGGCTTCATCAACAGGGAAGCCAA
CCTTCAGGCCCTCATCGCCACCGGGGGCGACATCAACGCC
GCCATCGAAAGACTGCTCGGCTCCCAGCCGTCCTAATTCC
ATCAGCTGAGAGCGTGTGAAGGGAGACAACAAGCAAACAT
AGTCCTCATCACATAAAATCTGACAAGCCCTACATAGACA
GAATTCCAATTACTCCAATCTTGTTTTTTTTTTTTTCTTC
TTCTTCTTTTTTGTTGCTTCAATCATTTGATCTCTAAATC
AAAGTAAAGAAGGTTTCAAAATTGTTTCCTGGATCACAAA
AAAAAAAAGCAAAGCAGCATCGCCGTGGAATGACGTCACA
CTAACCCCTCATCACTAGTAAGATGGGACAGAGCTTACAT
GTGCTGAACCAAGTCTAAGTTACCATTCCTTACAATTAGA
ACACACCGGCAGTACTCGGTGGTGATTAGGGGAATAAAAA
CATCCCTGCGCTTGAATTCCGAGGCCAGAGGGATTCTTGT
CTTCTGTGAGAATGCTTGGTTTTTCTTCATTTCTCTCTGT
TTCTCCTAATTCATGCCTGATCAAACCAGTATTTATTGCA
GAAATGTAGAGCTTACCCCCCTTTACTTCCTTTCCGGCCT
CCTCAGTTGACCATTTACTTTGTTTTCCTCCAGCGTTCCT
TGACATTTTGATGTGTTAATCGAAATCTAATAGACATGAT
CGTGTTGGAGCACTATAACACCTTGACTCTGATCGCTTTA
CACTTCAGCTATTTTAGAGAGGAATGAGGTTTTCAGTCAT
GCGATTTGCGGGAGAAAAAAAAAAAAAAGATATCCGGTCA
TCTCTTTAGTGGTTTGCCTTTGTGAGGAAGTGTACATGAA
TTGAGCGTAAAGGCTTGTCACCGCGGGGAAGGTTGTAACG
AAGCATCAATAAAATATTTCTCAGCTTAACAAACAGTGGC
GAACGCAGACACCGTTGTTTGTTTTGATCATCTCTTCATG
CTTTGACATAGAAGTTTTCTAGTGCCTGGATGCATCATCC
TCGAGTTGCTCTGGCGTACGCAAAAAACAAATGGGTTTGA
GCATGAAAGTGATGCTATAGCTTCTCTCAGCGCTAACCAA
CAGCCATCTAATGGAACTAACAAAGTTTTGATGTGAATTC
AAACGTTCAGCCTTGTTTATTTCGCTTTCTGCACATCCAT
AATACACTCTTTACTTGAATTACATTATGGAAACCGAGAG
TCACTGGGGTGTGTAGTTCTTTATTTTGATGTTAAACCAA
CATCTGGTTTTTGTCTTAAATCCTATGTGTTGCTGTCTGT
GATGTCGGTGTTCATAACACCACGCGGGTTTACTTTTATC
ATAGTTCAAGAAGTACTGCATGATCATATCTTCCTCTTGA
TTTACCCGAGGGTTGCGTTTATTGTTAATTTAGTGTGGAG
GTCACACAAAAGTGATTTGTTCTCGTTGATGCATTGTATA
GGCCTTTAATTTTGCTAAGCTTTAACCATTAAAAGCTTTA
AACATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations