header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-755
Transcript Name: ubqln4-201
Previous Names: ubin-001, ubqln4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046323 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046323|OTTDARG00000033038|ZDB-GENE-030131-6269 ubqln4|OTTDARP00000036546 ubin-001 LG_ BX323793.10 Danio rerio protein_coding KNOWN, 3328 bp
GTGAATTCGCGGACACGCCACACCACTAGAGGCCGCTGTG
GAACAACCGGCGTTTGCAGCACTTTTCTCCGCTGCTTGTT
GGTGCGATGATGTAATGAAGTAAAAGAAGAGTAAAGATGG
CGGAGAATAGCGGCACGGATCCTGCCGTGGAGACGAACAC
TGAAGAAAATGCCGCCGCTAGCGCGACTATCATTAAGGTT
ACCGTCAAAACACCGAAGGATAAAGAAGAAATAGCCATCG
CCGAGGACGCATCTGTCGCACAATTTAAAGAGGAAATCTC
CAAAAGATTTAAGGCGAAGCAAGACCAGTTGGTTTTGATT
TTTGCTGGTAAGATCCTGAAAGATGGAGACACTCTCGGTC
AGCATGGCATTAAAGACGGACTTACGGTTCACCTGGTCAT
CAAAACAGCACAAAAGACTTCGGGTGCTGGTAGTTCGCAG
ACCTCTGCCTCTTCTGGCCCTGGACCATCACAGGGCAGCC
CCTCTGGAACCGATACCCCTAGCCCGGCTGGTAACCTGGG
CACACCACAGGGCAGCGGGCCCTCCCCTACCCCATCACAG
CCAGCCAATATACTAGCTGGATTTGGTGACCTCTCAGGTC
TCTCTAATCTTGGTATGGGATCTGCCAACTTCATGGAGCT
TCAGCAACAGATGCAGCGACAGCTCATGTCCAACCCGGAG
ATGCTGTCTCAGATCATGGAGAATCCACTTGTGCAGAGCA
TGATGTCCAACCCTGACTTGATGAGGCAGATGATCATGGC
TAATCCACAGATGCAGCAGCTGATGGAGCGCAACCCCGAG
ATTTCACACATGCTTAATAACCCCGAGCTCATGAGACAGA
CAATGGAGTTGGCACGGAACCCAGCTATGATGCAAGAGAT
GATGCGTAACCAGGACAGGGCGCTTAGCAACCTAGAGAGT
ATTCCCGGAGGATATAATGCTCTCCGGAGGATGTACACAG
ACATTCAAGAGCCCATGTTTAGTGCTGCACGTGAACAGTT
TGGAAATAACCCCTTCTCAGCATTGGGTGGAAATGGTGAA
AACCCCGGAACGCAGCCCTCCAGGACAGAAAACAGAGAGC
CTCTGCCAAACCCCTGGGGGCCTCCTGACGGCACCGCTTC
CACCACCTCCTCTGGGACGCCCACCACCACCAGCTCCACC
ACAAGCTCAACCACACCCAGCGTGTCCAATCCTCTGGGCA
TTAGCTCCTCTAACCTTGGAAACGGTATGTTTAACAGTCC
TGGCATGCAAAGCCTAATGCAACAGATCTCGGAGAACCCT
CAGCTTATGCAGAACATGATTTCTGCTCCTTATATGCGCA
CCATGATGCAATCCCTGGCCCAGAATCCTGATGTTGCCTC
ACAGGTATTGATGAACAACCCTCTCTTTGCGGGAAATCCA
CAACTGCAAGAGCAGATGAGACAGCAGCTACCTGTATTTC
TACAGCAGATGCAGAACCCAGAAGCCCTTTCTGTCATGAC
AAATCCTCGAGCCATGAGAGCCCTAATGCAGATCCAGGAG
GGACTGCAAACCCTTCAAACTGAAGCCCCTGGACTTATGC
CCGGTCTGGGGCCTGGAGGAATGCCTGGTGGGATTCCCGT
TGGTATGCCTGGTGCCCCACTGCCCACAGGAGTGACTGTG
ACACCTGAGAATCCTCCGCCTTCCAGCCAGGGCTCCACCC
CAACCCCGACTGCTGGAGCCAGTCCTGCCCAGCAGCAGCT
CATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGCGCA
TCGACTCAGACTCCAGAAGTGCGTTTCCAGCAACAGCTGG
AGCAGCTGAGTGCCATGGGCTTCATCAACAGGGAAGCCAA
CCTTCAGGCCCTCATCGCCACCGGGGGCGACATCAACGCC
GCCATCGAAAGACTGCTCGGCTCCCAGCCGTCCTAATTCC
ATCAGCTGAGAGCGTGTGAAGGGAGACAACAAGCAAACAT
AGTCCTCATCACATAAAATCTGACAAGCCCTACATAGACA
GAATTCCAATTACTCCAATCTTGTTTTTTTTTTTTTCTTC
TTCTTCTTTTTTGTTGCTTCAATCATTTGATCTCTAAATC
AAAGTAAAGAAGGTTTCAAAATTGTTTCCTGGATCACAAA
AAAAAAAAGCAAAGCAGCATCGCCGTGGAATGACGTCACA
CTAACCCCTCATCACTAGTAAGATGGGACAGAGCTTACAT
GTGCTGAACCAAGTCTAAGTTACCATTCCTTACAATTAGA
ACACACCGGCAGTACTCGGTGGTGATTAGGGGAATAAAAA
CATCCCTGCGCTTGAATTCCGAGGCCAGAGGGATTCTTGT
CTTCTGTGAGAATGCTTGGTTTTTCTTCATTTCTCTCTGT
TTCTCCTAATTCATGCCTGATCAAACCAGTATTTATTGCA
GAAATGTAGAGCTTACCCCCCTTTACTTCCTTTCCGGCCT
CCTCAGTTGACCATTTACTTTGTTTTCCTCCAGCGTTCCT
TGACATTTTGATGTGTTAATCGAAATCTAATAGACATGAT
CGTGTTGGAGCACTATAACACCTTGACTCTGATCGCTTTA
CACTTCAGCTATTTTAGAGAGGAATGAGGTTTTCAGTCAT
GCGATTTGCGGGAGAAAAAAAAAAAAAAGATATCCGGTCA
TCTCTTTAGTGGTTTGCCTTTGTGAGGAAGTGTACATGAA
TTGAGCGTAAAGGCTTGTCACCGCGGGGAAGGTTGTAACG
AAGCATCAATAAAATATTTCTCAGCTTAACAAACAGTGGC
GAACGCAGACACCGTTGTTTGTTTTGATCATCTCTTCATG
CTTTGACATAGAAGTTTTCTAGTGCCTGGATGCATCATCC
TCGAGTTGCTCTGGCGTACGCAAAAAACAAATGGGTTTGA
GCATGAAAGTGATGCTATAGCTTCTCTCAGCGCTAACCAA
CAGCCATCTAATGGAACTAACAAAGTTTTGATGTGAATTC
AAACGTTCAGCCTTGTTTATTTCGCTTTCTGCACATCCAT
AATACACTCTTTACTTGAATTACATTATGGAAACCGAGAG
TCACTGGGGTGTGTAGTTCTTTATTTTGATGTTAAACCAA
CATCTGGTTTTTGTCTTAAATCCTATGTGTTGCTGTCTGT
GATGTCGGTGTTCATAACACCACGCGGGTTTACTTTTATC
ATAGTTCAAGAAGTACTGCATGATCATATCTTCCTCTTGA
TTTACCCGAGGGTTGCGTTTATTGTTAATTTAGTGTGGAG
GTCACACAAAAGTGATTTGTTCTCGTTGATGCATTGTATA
GGCCTTTAATTTTGCTAAGCTTTAACCATTAAAAGCTTTA
AACATTAA

ubqln4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ubqln4-201 3328
ubqln4-202 (1)    Ensembl 2395
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubqln4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046323 (1),  Ensembl_Trans:ENSDART00000074919 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC098879 (1) 3237 bp
GenBank:CN015454 (1) 935 bp
GenBank:EB934712 (1) 649 bp
CITATIONS (2)