header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1271
Transcript Name: ubqln4-202
Previous Names: ubin-002, ubqln4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046324 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046324|OTTDARG00000033038|ZDB-GENE-030131-6269 ubqln4|OTTDARP00000036547 ubin-002 LG_ BX323793.10 Danio rerio protein_coding KNOWN, 2395 bp
GTAATGAAGTAAAAGAAGAGTAAAGATGGCGGAGAATAGC
GGCACGGATCCTGCCGTGGAGACGAACACTGAAGAAAATG
CCGCCGCTAGCGCGACTATCATTAAGGTTACCGTCAAAAC
ACCGAAGGATAAAGAAGAAATAGCCATCGCCGAGGACGCA
TCTGTCGCACAATTTAAAGAGGAAATCTCCAAAAGATTTA
AGGCGAAGCAAGACCAGTTGGTTTTGATTTTTGCTGGTAA
GATCCTGAAAGATGGAGACACTCTCGGTCAGCATGGCATT
AAAGACGGACTTACGGTTCACCTGGTCATCAAAACAGCAC
AAAAGACTTCGGGTGCTGGTAGTTCGCAGACCTCTGCCTC
TTCTGGCCCTGGACCATCACAGGGCAGCCCCTCTGGAACC
GATACCCCTAGCCCGGCTGGTAACCTGGGCACACCACAGG
GCAGCGGGCCCTCCCCTACCCCATCACAGCCAGCCAATAT
ACTAGCTGGATTTGGTGACCTCTCAGGTCTCTCTAATCTT
GGTATGGGATCTGCCAACTTCATGGAGCTTCAGCAACAGA
TGCAGCGACAGCTCATGTCCAACCCGGAGATGCTGTCTCA
GATCATGGAGAATCCACTTGTGCAGAGCATGATGTCCAAC
CCTGACTTGATGAGGCAGATGATCATGGCTAATCCACAGA
TGCAGCAGCTGATGGAGCGCAACCCCGAGATTTCACACAT
GCTTAATAACCCCGAGCTCATGAGACAGACAATGGAGTTG
GCACGGAACCCAGCTATGATGCAAGAGATGATGCGTAACC
AGGACAGGGCGCTTAGCAACCTAGAGAGTATTCCCGGAGG
ATATAATGCTCTCCGGAGGATGTACACAGACATTCAAGAG
CCCATGTTTAGTGCTGCACGTGAACAGTTTGGAAATAACC
CCTTCTCAGCATTGGGTGGAAATGGTGAAAACCCCGGAAC
GCAGCCCTCCAGGACAGAAAACAGAGAGCCTCTGCCAAAC
CCCTGGGGGCCTCCTGACGGCACCGCTTCCACCACCTCCT
CTGGGACGCCCACCACCACCAGCTCCACCACAAGCTCAAC
CACACCCAGCGTGTCCAATCCTCTGGGCATTAGCTCCTCT
AACCTTGGAAACGGTATGTTTAACAGTCCTGGCATGCAAA
GCCTAATGCAACAGATCTCGGAGAACCCTCAGCTTATGCA
GAACATGATTTCTGCTCCTTATATGCGCACCATGATGCAA
TCCCTGGCCCAGAATCCTGATGTTGCCTCACAGGGCTCCA
CCCCAACCCCGACTGCTGGAGCCAGTCCTGCCCAGCAGCA
GCTCATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGC
GCATCGACTCAGACTCCAGAAGTGCGTTTCCAGCAACAGC
TGGAGCAGCTGAGTGCCATGGGCTTCATCAACAGGGAAGC
CAACCTTCAGGCCCTCATCGCCACCGGGGGCGACATCAAC
GCCGCCATCGAAAGACTGCTCGGCTCCCAGCCGTCCTAAT
TCCATCAGCTGAGAGCGTGTGAAGGGAGACAACAAGCAAA
CATAGTCCTCATCACATAAAATCTGACAAGCCCTACATAG
ACAGAATTCCAATTACTCCAATCTTGTTTTTTTTTTTTTC
TTCTTCTTCTTTTTTGTTGCTTCAATCATTTGATCTCTAA
ATCAAAGTAAAGAAGGTTTCAAAATTGTTTCCTGGATCAC
AAAAAAAAAAAGCAAAGCAGCATCGCCGTGGAATGACGTC
ACACTAACCCCTCATCACTAGTAAGATGGGACAGAGCTTA
CATGTGCTGAACCAAGTCTAAGTTACCATTCCTTACAATT
AGAACACACCGGCAGTACTCGGTGGTGATTAGGGGAATAA
AAACATCCCTGCGCTTGAATTCCGAGGCCAGAGGGATTCT
TGTCTTCTGTGAGAATGCTTGGTTTTTCTTCATTTCTCTC
TGTTTCTCCTAATTCATGCCTGATCAAACCAGTATTTATT
GCAGAAATGTAGAGCTTACCCCCCTTTACTTCCTTTCCGG
CCTCCTCAGTTGACCATTTACTTTGTTTTCCTCCAGCGTT
CCTTGACATTTTGATGTGTTAATCGAAATCTAATAGACAT
GATCGTGTTGGAGCACTATAACACCTTGACTCTGATCGCT
TTACACTTCAGCTATTTTAGAGAGGAATGAGGTTTTCAGT
CATGCGATTTGCGGGAGAAAAAAAAAAAAAAGATATCCGG
TCATCTCTTTAGTGGTTTGCCTTTGTGAGGAAGTGTACAT
GAATTGAGCGTAAAGGCTTGTCACCGCGGGGAAGGTTGTA
ACGAAGCATCAATAAAATATTTCTCAGCTTAACAAACAGT
GGCGAACGCAGACACCGTTGTTTGTTTTGATCATC

ubqln4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ubqln4-201 (1)    Ensembl 3328
ubqln4-202 2395
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubqln4-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046324 (1),  Ensembl_Trans:ENSDART00000142698 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055536 (1) 2406 bp
CITATIONS (2)