Transcript

ubqln4-202

ID
ZDB-TSCRIPT-100915-1271
Name
ubqln4-202
Previous Names
  • ubin-002
  • ubqln4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046324 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046324|OTTDARG00000033038|ZDB-GENE-030131-6269 ubqln4|OTTDARP00000036547 ubin-002 LG_ BX323793.10 Danio rerio protein_coding KNOWN, 2395 bp
GTAATGAAGTAAAAGAAGAGTAAAGATGGCGGAGAATAGC
GGCACGGATCCTGCCGTGGAGACGAACACTGAAGAAAATG
CCGCCGCTAGCGCGACTATCATTAAGGTTACCGTCAAAAC
ACCGAAGGATAAAGAAGAAATAGCCATCGCCGAGGACGCA
TCTGTCGCACAATTTAAAGAGGAAATCTCCAAAAGATTTA
AGGCGAAGCAAGACCAGTTGGTTTTGATTTTTGCTGGTAA
GATCCTGAAAGATGGAGACACTCTCGGTCAGCATGGCATT
AAAGACGGACTTACGGTTCACCTGGTCATCAAAACAGCAC
AAAAGACTTCGGGTGCTGGTAGTTCGCAGACCTCTGCCTC
TTCTGGCCCTGGACCATCACAGGGCAGCCCCTCTGGAACC
GATACCCCTAGCCCGGCTGGTAACCTGGGCACACCACAGG
GCAGCGGGCCCTCCCCTACCCCATCACAGCCAGCCAATAT
ACTAGCTGGATTTGGTGACCTCTCAGGTCTCTCTAATCTT
GGTATGGGATCTGCCAACTTCATGGAGCTTCAGCAACAGA
TGCAGCGACAGCTCATGTCCAACCCGGAGATGCTGTCTCA
GATCATGGAGAATCCACTTGTGCAGAGCATGATGTCCAAC
CCTGACTTGATGAGGCAGATGATCATGGCTAATCCACAGA
TGCAGCAGCTGATGGAGCGCAACCCCGAGATTTCACACAT
GCTTAATAACCCCGAGCTCATGAGACAGACAATGGAGTTG
GCACGGAACCCAGCTATGATGCAAGAGATGATGCGTAACC
AGGACAGGGCGCTTAGCAACCTAGAGAGTATTCCCGGAGG
ATATAATGCTCTCCGGAGGATGTACACAGACATTCAAGAG
CCCATGTTTAGTGCTGCACGTGAACAGTTTGGAAATAACC
CCTTCTCAGCATTGGGTGGAAATGGTGAAAACCCCGGAAC
GCAGCCCTCCAGGACAGAAAACAGAGAGCCTCTGCCAAAC
CCCTGGGGGCCTCCTGACGGCACCGCTTCCACCACCTCCT
CTGGGACGCCCACCACCACCAGCTCCACCACAAGCTCAAC
CACACCCAGCGTGTCCAATCCTCTGGGCATTAGCTCCTCT
AACCTTGGAAACGGTATGTTTAACAGTCCTGGCATGCAAA
GCCTAATGCAACAGATCTCGGAGAACCCTCAGCTTATGCA
GAACATGATTTCTGCTCCTTATATGCGCACCATGATGCAA
TCCCTGGCCCAGAATCCTGATGTTGCCTCACAGGGCTCCA
CCCCAACCCCGACTGCTGGAGCCAGTCCTGCCCAGCAGCA
GCTCATGCAGCAGATGCTACAGATGTTTGCTGGAGGGAGC
GCATCGACTCAGACTCCAGAAGTGCGTTTCCAGCAACAGC
TGGAGCAGCTGAGTGCCATGGGCTTCATCAACAGGGAAGC
CAACCTTCAGGCCCTCATCGCCACCGGGGGCGACATCAAC
GCCGCCATCGAAAGACTGCTCGGCTCCCAGCCGTCCTAAT
TCCATCAGCTGAGAGCGTGTGAAGGGAGACAACAAGCAAA
CATAGTCCTCATCACATAAAATCTGACAAGCCCTACATAG
ACAGAATTCCAATTACTCCAATCTTGTTTTTTTTTTTTTC
TTCTTCTTCTTTTTTGTTGCTTCAATCATTTGATCTCTAA
ATCAAAGTAAAGAAGGTTTCAAAATTGTTTCCTGGATCAC
AAAAAAAAAAAGCAAAGCAGCATCGCCGTGGAATGACGTC
ACACTAACCCCTCATCACTAGTAAGATGGGACAGAGCTTA
CATGTGCTGAACCAAGTCTAAGTTACCATTCCTTACAATT
AGAACACACCGGCAGTACTCGGTGGTGATTAGGGGAATAA
AAACATCCCTGCGCTTGAATTCCGAGGCCAGAGGGATTCT
TGTCTTCTGTGAGAATGCTTGGTTTTTCTTCATTTCTCTC
TGTTTCTCCTAATTCATGCCTGATCAAACCAGTATTTATT
GCAGAAATGTAGAGCTTACCCCCCTTTACTTCCTTTCCGG
CCTCCTCAGTTGACCATTTACTTTGTTTTCCTCCAGCGTT
CCTTGACATTTTGATGTGTTAATCGAAATCTAATAGACAT
GATCGTGTTGGAGCACTATAACACCTTGACTCTGATCGCT
TTACACTTCAGCTATTTTAGAGAGGAATGAGGTTTTCAGT
CATGCGATTTGCGGGAGAAAAAAAAAAAAAAGATATCCGG
TCATCTCTTTAGTGGTTTGCCTTTGTGAGGAAGTGTACAT
GAATTGAGCGTAAAGGCTTGTCACCGCGGGGAAGGTTGTA
ACGAAGCATCAATAAAATATTTCTCAGCTTAACAAACAGT
GGCGAACGCAGACACCGTTGTTTGTTTTGATCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations