ZFIN ID: ZDB-TSCRIPT-100915-723
Transcript Name: gapdh-204
Previous Name: gapdh-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046201 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046201|OTTDARG00000032973|ZDB-GENE-030115-1 gapdh|OTTDARP00000036461 gapdh-002 LG_ CU861451.12 Danio rerio protein_coding KNOWN, 902 bp
ATAATCAGTGCTCGTAAACCATGATCCACACAAGAGAACA
GAGTTTAAACAGTCAGCAACTTGTCAGCAAAGTTCAACAA
ACTGCTCGGCTAAAATTCCACCTGAAGAAAATTAGTTATC
TGGAGTGAACTTGATGTGACGTGACAGACGTGCGATTTGT
GTCCATCAGGGTTACGTTCAGAAGCTCGTCTGGTTCTGCC
TGAATCATAGGACACAACCAAATCAGGCATAATGGTTAAA
GTTGGTATTAACGGATTCGGTCGCATTGGCCGTCTGGTGA
CCCGTGCTGCTTTCTTGACCAAGAAAGTGGAGATTGTGGC
CATCAATGACCCATTCATTGACCTTGATTACATGGTTTAC
ATGTTCCAGTACGACTCCACCCATGGAAAGTACAAGGGTG
AGGTTAAGGCAGAAGGCGGCAAACTGGTCATTGATGGTCA
TGCAATCACAGTCTATAGCGAGAGGGACCCAGCCAATATT
AAGTGGGGTGATGCAGGTGCTACTTATGTTGTGGAGTCTA
CTGGTGTCTTCACTACTATTGAGAAGGCTTCTGCTCACAT
TAAGGGTGGTGCAAAGAGAGTCATCATCTCTGCCCCAAGT
GCAGATGCCCCCATGTTTGTCATGGGTGTCAACCATGAGA
AATATGACAACTCTCTCACAGTTGTAAGCAATGCCTCCTG
CACCACCAACTGCCTGGCTCCTTTGGCAAAGGTCATTAAT
GATAACTTTGTCATCGTTGAAGGTCTTATGAGCACTGTTC
ATGCCATCACAGCAACACAGAAGACCGTTGATGGGCCCTC
TGGGAAGCTGTGGAGGGATGGCCGTGGTGCCAGTCAGAAC
ATCATCCCAGCCTCCACTGGGGCTGCCAAGGCTGTAGGCA
AAGTAATTCCTGAGCTCAATGG

gapdh TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gapdh-201 (1)    Ensembl 1331
gapdh-202 (1)    Ensembl 445
gapdh-203 (1)    Ensembl 825
gapdh-204 902
ncRNA gapdh-005 (1)    Ensembl 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gapdh-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046201 (1),  Ensembl_Trans:ENSDART00000147739 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE694652 (1) 922 nt
GenBank:CN330181 (1) 857 nt
GenBank:DN799777 (1) 795 nt
GenBank:DN834252 (1) 755 nt
CITATIONS (2)