Transcript

gapdh-204

ID
ZDB-TSCRIPT-100915-723
Name
gapdh-204
Previous Names
  • gapdh-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046201 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046201|OTTDARG00000032973|ZDB-GENE-030115-1 gapdh|OTTDARP00000036461 gapdh-002 LG_ CU861451.12 Danio rerio protein_coding KNOWN, 902 bp
ATAATCAGTGCTCGTAAACCATGATCCACACAAGAGAACA
GAGTTTAAACAGTCAGCAACTTGTCAGCAAAGTTCAACAA
ACTGCTCGGCTAAAATTCCACCTGAAGAAAATTAGTTATC
TGGAGTGAACTTGATGTGACGTGACAGACGTGCGATTTGT
GTCCATCAGGGTTACGTTCAGAAGCTCGTCTGGTTCTGCC
TGAATCATAGGACACAACCAAATCAGGCATAATGGTTAAA
GTTGGTATTAACGGATTCGGTCGCATTGGCCGTCTGGTGA
CCCGTGCTGCTTTCTTGACCAAGAAAGTGGAGATTGTGGC
CATCAATGACCCATTCATTGACCTTGATTACATGGTTTAC
ATGTTCCAGTACGACTCCACCCATGGAAAGTACAAGGGTG
AGGTTAAGGCAGAAGGCGGCAAACTGGTCATTGATGGTCA
TGCAATCACAGTCTATAGCGAGAGGGACCCAGCCAATATT
AAGTGGGGTGATGCAGGTGCTACTTATGTTGTGGAGTCTA
CTGGTGTCTTCACTACTATTGAGAAGGCTTCTGCTCACAT
TAAGGGTGGTGCAAAGAGAGTCATCATCTCTGCCCCAAGT
GCAGATGCCCCCATGTTTGTCATGGGTGTCAACCATGAGA
AATATGACAACTCTCTCACAGTTGTAAGCAATGCCTCCTG
CACCACCAACTGCCTGGCTCCTTTGGCAAAGGTCATTAAT
GATAACTTTGTCATCGTTGAAGGTCTTATGAGCACTGTTC
ATGCCATCACAGCAACACAGAAGACCGTTGATGGGCCCTC
TGGGAAGCTGTGGAGGGATGGCCGTGGTGCCAGTCAGAAC
ATCATCCCAGCCTCCACTGGGGCTGCCAAGGCTGTAGGCA
AAGTAATTCCTGAGCTCAATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations