ZFIN ID: ZDB-TSCRIPT-100915-209
Transcript Name: gapdh-201
Previous Name: gapdh-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046200 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046200|OTTDARG00000032973|ZDB-GENE-030115-1 gapdh|OTTDARP00000036460 gapdh-001 LG_ CU861451.12 Danio rerio protein_coding KNOWN, 1331 bp
TAACCTCGTGTTCGTAATCAGTCCACTCACACCAAGTGTC
AGGACGAACAGAGGCTTCTCACAAACGAGGACACAACCAA
ATCAGGCATAATGGTTAAAGTTGGTATTAACGGATTCGGT
CGCATTGGCCGTCTGGTGACCCGTGCTGCTTTCTTGACCA
AGAAAGTGGAGATTGTGGCCATCAATGACCCATTCATTGA
CCTTGATTACATGGTTTACATGTTCCAGTACGACTCCACC
CATGGAAAGTACAAGGGTGAGGTTAAGGCAGAAGGCGGCA
AACTGGTCATTGATGGTCATGCAATCACAGTCTATAGCGA
GAGGGACCCAGCCAATATTAAGTGGGGTGATGCAGGTGCT
ACTTATGTTGTGGAGTCTACTGGTGTCTTCACTACTATTG
AGAAGGCTTCTGCTCACATTAAGGGTGGTGCAAAGAGAGT
CATCATCTCTGCCCCAAGTGCAGATGCCCCCATGTTTGTC
ATGGGTGTCAACCATGAGAAATATGACAACTCTCTCACAG
TTGTAAGCAATGCCTCCTGCACCACCAACTGCCTGGCTCC
TTTGGCAAAGGTCATTAATGATAACTTTGTCATCGTTGAA
GGTCTTATGAGCACTGTTCATGCCATCACAGCAACACAGA
AGACCGTTGATGGGCCCTCTGGGAAGCTGTGGAGGGATGG
CCGTGGTGCCAGTCAGAACATCATCCCAGCCTCCACTGGG
GCTGCCAAGGCTGTAGGCAAAGTAATTCCTGAGCTCAATG
GCAAGCTTACTGGTATGGCCTTCCGTGTCCCCACCCCCAA
TGTCTCTGTTGTGGATCTGACAGTCCGTCTTGAGAAACCT
GCCAAGTATGATGAGATCAAGAAAGTCGTCAAGGCTGCAG
CTGATGGGCCCATGAAAGGAATTCTGGGATACACGGAGCA
CCAGGTTGTGTCCACTGACTTCAATGGGGATTGCCGTTCA
TCCATCTTTGACGCTGGTGCTGGTATTGCTCTCAACGATC
ACTTTGTCAAGCTGGTCACATGGTATGACAATGAGTTCGG
TTACAGCAACCGTGTATGTGACCTGATGGCACACATGGCC
TCCAAGGAGTAGATGTGACCCCTTTGCTGTTTCTTTTTTT
TGATACGCGACCATTCTCCCATCTGGTTGAATGTTTGCAC
CACGTGCCTGGAAGGAAATTACATGCTTAAATTGAAGACC
AATATTATTTTTATATACTCTGTTCTGTTTCGTGTGTGAG
GTTAAAAATAAATGTTGACTTCAAAGGCTTTTCTGTCTGT
TAACAACTTGCGATGGAATAAAAGTCCTCTGTTTGTGAGA
AATGGAGAAAA

gapdh TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gapdh-201 1331
gapdh-202 (1)    Ensembl 445
gapdh-203 (1)    Ensembl 825
gapdh-204 (1)    Ensembl 902
ncRNA gapdh-005 (1)    Ensembl 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gapdh-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046200 (1),  Ensembl_Trans:ENSDART00000063800 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC083506 (1) 1391 nt
GenBank:BC115131 (1) 1324 nt
GenBank:CO352503 (1) 580 nt
GenBank:EH520312 (1) 210 nt
CITATIONS (2)