header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-650
Transcript Name: tjp3-202
Previous Name: tjp3-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045914 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045914|OTTDARG00000032754|ZDB-GENE-030828-10 tjp3|OTTDARP00000036226 tjp3-004 LG_none CU695074.11,CU856138.6 Danio rerio protein_coding KNOWN, 2861 bp
TGTGAGCAGCCGTTTCTGAGTCAGATTCAGACCGGAGCGC
ATCTCCACCGCCCAGACGTGAGAGTCCCAGACCTGATAAC
CACTCCAGATACAAGGTGCTTCCTGATCTCCCCCCTCCAG
GTTTGAAGCCTTCTTCTCTTAGCATGTCTCAGGATTTCCC
TCGCCGCATGGCTTCACCTTACAGGCCTCCACCTAGAGAT
GCTTCAGAGTCTGAATCGGACGAAAGTGCCAGACCTCAGC
GCAGACAGGGGACTCCGGCCAGCCAAGAGTCCCGCAATAG
ATACAGGGCTGCCCCTGAAGTGAAGGCAGCAGCAGTAATG
GAGCCCCCAAAATGGGCGAAACCCTCAACGCCTGTACAGA
GAGCTCCCTCAGAATCTGAATCAGATGGAAGTTACAACTC
TCCACCCAAACAACCTCCGTCTCCAGTCAGTAAAAGCTCC
AGAATCAAAGGGCCTGAAATGCAAATGCCAATCACCAGCA
TCCGGCAGGATCCTCCACTCAGAGCCGCTCCTGCCAGACC
ACCTCCCGAAGATTCCTCTGACTCAGAAAGAGCCCAGTCA
CCTCTCAGGAGATCTGACAGTCACAACAGCGATCACAGTT
TCCCACGTGCTAATGGGACTCTCCGCTCGAACGTCTCCAT
CCCCAACCACACTGCGCTGACTTCTAAAGCTGTAGAAGAA
CCACTTTATGTGCTTCCACCAGACGCAGTGCCAACACCAA
ACCTGGGGTACAGCTCCGATCAGAACCATATCAGCTTTGT
GAAGGAAGGCAGTGTCGGCTTGAGACTTGTGGGAGGAAAT
GATGTTGGCATCTTTGTCGGTGGTGTCCAGCCTAACAGTC
CAGCCCAAAAGCAAGGCATAACAGAGGGTGATCAGATTCT
GGAGGTAAATGGCATGGATTTTAACCACTTTACCAGAGAA
GAAGCAGCAATGTATCTTATGAACATACGTGGTGGAGAGC
GTATCGATATGCGGACTCAGAACAAAGCAGACATCTACAA
GAAGATTCTGAAGTCCAACCTTGGAGATTCTTTCTACATC
CGCACACACTATGATCATGTGGCAGACAGCAGCGTCGGCT
TAAGCTTTACCAGAGGCGAGGTGTTCAGAGTGGTGGACAC
TATGCATCGAGGAAAGCTGGGGACCTGGTTAGCTGTGCGC
ATGGGCAATGATCTACACGAACTGGACAAAGGGACCATTC
CTAACCAGACCAGGGCTGAAACTCTGGCTAATTTGGAGCA
GGCGCAGAGAATTAGTGCAGCTGAACGTCAGGCATCTGGC
CCCAGAGCTGAATTCTGGAAGCTACGGGGTCTCAGAGGGG
CCAAAAAGAGTAACCGAAGAACCCGTGATGACCTCCTGCA
GTTGACAATTCAAGGCAAATTTCCAGCATACGAGAAGGTC
CTGTTGAAAGAAGCCAATTTCAAACGTCCTATTGTCATCT
TGGGTCCTCTGAATGACATTGCCAATGAAAAACTGGCCCG
AGAGTTGCCTGATGAATTTGAAATTGCAGAAATGGTACCC
AGGAGTGGAAATGATAGTTCATCAAGTGTAATCAAACTGG
ACACCGTAAGGCGGATAGCGGAGCAGGACAAGCATCCCTT
GCTGGACATTACACCCACTGCCATAGAAAGATTGAATTAT
ATCCAGTACCATCCCATGGTGCTCTTCTTGGATCCTCATA
GTCGGAAGGACGTGAAGTCTATGAGGCAAAAATACATGCC
AGGCTCCAGCAAGAGCTCTCGACGCCTCTATGCCCAGGCC
TTAAAGCTAAGGAAAAACTACAGCACTCTGTTTTCTGCAC
GCATTGATCTTCAGCCAAATACAAACATGTGGTATGATGT
TTTGAAAGACAAGATTCGGCAACAGCAGTCTAAGCCTGTC
TGGGTTTCTGAAGTAGCGATGGAAGGAGGAGCCGAAGAGG
ATCTTGACGCATTTAATCGAGCAAACAACTCTGACTATCT
CAGCGGTGCCAGTGACTACGAGGACACTGACGGTGAGGCC
TTCACAGACGGTGAAGCCTACACGGACAATGAAGACCTGG
AGGAACCCTTAGGAGGCATTGCCAAACACCGCAGCTCTGC
GCTGGCCCGTTCTTCGGAGCCTGCCAGTGTGTTAAATCAT
AGCCCTGAACCTCCCTACAACCTACACGAGGAGGAGGAAG
AGCCAGAGTACACCCTACCGCCCAGTGAAGTTCCTCCCAT
CCTCCATGTTCCCGAGCCCCGATCTCCACGCCTTGTTGCT
GGAATACCAGAAGAGCAAGAGGATGTGCCCTCGCAGCGCA
GTTTCACAGATTCAGACTTCAGCAATGATGATGTTGTTGC
ACCTCAAACACCTTCCGATGCGCCACCCAAATTCAGGGCA
CCAGATCCCAAAGATGTCCAGTCAAAGACCCCTCCACTGT
CAGCCATAGAGGAGAGACTACAACAGGCTCGCATGGCAGA
ACAGATTGAACCAGAAAGGAAACCTTCGCCTTCTTTTATA
GTACTCGCACATCATGAAGCCATGCAAATGCGGAGAACGC
AAATCCGAGGAAGCGACAGTGACAGCGACGAAAACGACAG
AGATGAAGACGAATATGACGAAGCAGAAGACATTGAATGG
GGACCTGCTACAGAGCTGTAATATACATGGATTACACTAC
ATTAAGACCCAAAACGGGGACATGGACCTTTAATCTGGAC
TTGTACAGTACATTCACACAACCAAACGTTTTTGTATTGA
CTTTCGTAATTTGGAATCGATTTGTGACCTGAATCGCTTG
CTTTTTGTGGGTCACATTGTTTTAATAGATGTTCTGAGGT
CAAACTCAGGATTATTTCAAAAAGAAATATTTCCTGTTGT
TTTTTTAAAAAAAGTATGATT

tjp3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tjp3-202 2861
tjp3-203 (1)    Ensembl 880
tjp3-204 (1)    Ensembl 1848
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tjp3-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045914 (1),  Ensembl_Trans:ENSDART00000137995 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE715185 (1) 970 bp
GenBank:EG583202 (1) 926 bp
GenBank:EE325258 (1) 844 bp
GenBank:CK026254 (1) 804 bp
GenBank:CN505530 (1) 781 bp
GenBank:BI885944 (1) 637 bp
CITATIONS (2)