Transcript

tjp3-204

ID
ZDB-TSCRIPT-091203-107
Name
tjp3-204
Previous Names
  • tjp3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045832|OTTDARG00000032754|ZDB-GENE-030828-10 tjp3|OTTDARP00000036164 tjp3-002 LG_none CU695074.11,CU856138.6 Danio rerio protein_coding KNOWN, 1848 bp
CGAAACTGCCCGACCTGTCTTAAACTCCTCCCCCTGCTTA
CAGGTACATGGTCAGGTGCTGTAGTAATGCAGGGCAATAT
AACGAAAGCTTTTTTAGAAATCTGCAGGTGCCAGGCCCAG
TAAGGCCTGCGATACGGAGCTAACTGTATATTTTAGGGTT
GTTTTTTTAAAGTGGTGCGTAATAAGAAATCAGTCATGGA
GGAGATGACGATATGGGAGCAGCACACGGTCACGTTATCG
AAAGATTCCAAGGTGGGCTTTGGTTTTGCCGTCTCAGGTG
GGCTGGACAAACCCAACCCAGCAAATGGGGACGCGGCAGT
GGTGGTCTCTGATGTGATTCCCACCGGTCCCGCCATGGGC
CGACTTCAGACGCGAGATCAGATTGTTATGGTGAATGGTG
TTTCAATGGAGAACGTCACTTCACTCTACACCATACAGAA
TCTGAGGAAGTGCGGGAAGACCGCTAACATTACTGTGAAG
AGGCCGCGCACGATCCAGATTCCTGCCAGCAGCAGACCCA
CTCGCTCAGCCTCTCAGTCCAACATTTTAGACGATAAAGG
ACCTCAGTATAAGGGTCAGCGGGGCCCTGACACCACACGC
ACCCGCCGGGCCCGAAGCGTCACTCCTGACCGCAATGGCC
ACGATCTGCCCATCACATCCGGATACAAGCGACTGCCCAA
TCAGGACGTCCAGAACAAACCCATCAAGACCACTCTGATC
AAGAAGAAGCCCACCGACGAGTATGGAATGAAGCTGGGGA
GCCAGATCTTCATCAAGCACATGACTCCCACCGGTCTGGC
TGCCAAAGAAGGCTCGCTTCAGGAGGGAGATCTGGTTTTA
AAGATTAACGGCATGACAACAGAAAACCTGTCCCTGCTGG
AGACCAAGCATCTGGTGGAGAAATCCAGAGGGAACCTGAC
CATGCTGGTGCTGAGAGACGACAGAAAGTTTCTGGTCAGC
ATCCCTGAAGTGGAGGACAGTCCTCAAAACAGCTCAGACG
AGAGGCGGGAGGACAGCAGCTCTGAGCTGGAGGAAATCTC
AGACCTGGATTCGGACCTTCCCGTTACAAACCGAGCATCT
CGTCGCAAAGACCGAAAATCGAACAGAAACCGGGCTGATC
CTGTGTCGAAAAAACTTGAATCCCCTCCTCTGCGCTCAAC
TCTCACAAGACCTGCTCAGTCTATGCCTCCTCGCAGAGTT
CCCTCGGAGTCTGAATCTGATCGCAGCAACTCTCCTCCAC
CAAGACATGACACTCTCGATCACAGAAACAAGGTTCTCTC
TGGGTACTCCACACTGCCAAACCCTCGAGCTTCACCCATC
ACCTCCTCCTCCACATCCCGGCCTCGCAGAGCCGTTTCTG
AGTCAGATTCAGACCGGAGCGCATCTCCACCGCCCAGACG
TGAGAGTCCCAGACCTGATAACCACTCCAGATACAAGGTG
CTTCCTGATCTCCCCCCTCCAGGTTTGAAGCCTTCTTCTC
TTAGCATGTCTCAGGATTTCCCTCGCCGCATGGCTTCACC
TTACAGGCCTCCACCTAGAGATGCTTCAGAGTCTGAATCG
GACGAAAGTGCCAGACCTCAGCGCAGACAGGGGACTCCGG
CCAGCCAAGAGTCCCGCAATAGATACAGGTACACATGAGG
GACGCCTCACTGCCACTTTTTACCCAACTCCCATCGGGCT
CTTTCTGTAGGGCCGACCATCATCCTGCATACGATGACAA
AGAAACGTTCAATGTTGTTTTTGATTCATTTCGATTATGT
TGCTTGTATACGTTCATGTATTTCTGCTTCATTGTGTTCT
CTGGAAATGTGATATATGTGTGTGCTTTTAAAAATAAAAG
ACACCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations