header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-107
Transcript Name: tjp3-204
Previous Name: tjp3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045832 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045832|OTTDARG00000032754|ZDB-GENE-030828-10 tjp3|OTTDARP00000036164 tjp3-002 LG_none CU695074.11,CU856138.6 Danio rerio protein_coding KNOWN, 1848 bp
CGAAACTGCCCGACCTGTCTTAAACTCCTCCCCCTGCTTA
CAGGTACATGGTCAGGTGCTGTAGTAATGCAGGGCAATAT
AACGAAAGCTTTTTTAGAAATCTGCAGGTGCCAGGCCCAG
TAAGGCCTGCGATACGGAGCTAACTGTATATTTTAGGGTT
GTTTTTTTAAAGTGGTGCGTAATAAGAAATCAGTCATGGA
GGAGATGACGATATGGGAGCAGCACACGGTCACGTTATCG
AAAGATTCCAAGGTGGGCTTTGGTTTTGCCGTCTCAGGTG
GGCTGGACAAACCCAACCCAGCAAATGGGGACGCGGCAGT
GGTGGTCTCTGATGTGATTCCCACCGGTCCCGCCATGGGC
CGACTTCAGACGCGAGATCAGATTGTTATGGTGAATGGTG
TTTCAATGGAGAACGTCACTTCACTCTACACCATACAGAA
TCTGAGGAAGTGCGGGAAGACCGCTAACATTACTGTGAAG
AGGCCGCGCACGATCCAGATTCCTGCCAGCAGCAGACCCA
CTCGCTCAGCCTCTCAGTCCAACATTTTAGACGATAAAGG
ACCTCAGTATAAGGGTCAGCGGGGCCCTGACACCACACGC
ACCCGCCGGGCCCGAAGCGTCACTCCTGACCGCAATGGCC
ACGATCTGCCCATCACATCCGGATACAAGCGACTGCCCAA
TCAGGACGTCCAGAACAAACCCATCAAGACCACTCTGATC
AAGAAGAAGCCCACCGACGAGTATGGAATGAAGCTGGGGA
GCCAGATCTTCATCAAGCACATGACTCCCACCGGTCTGGC
TGCCAAAGAAGGCTCGCTTCAGGAGGGAGATCTGGTTTTA
AAGATTAACGGCATGACAACAGAAAACCTGTCCCTGCTGG
AGACCAAGCATCTGGTGGAGAAATCCAGAGGGAACCTGAC
CATGCTGGTGCTGAGAGACGACAGAAAGTTTCTGGTCAGC
ATCCCTGAAGTGGAGGACAGTCCTCAAAACAGCTCAGACG
AGAGGCGGGAGGACAGCAGCTCTGAGCTGGAGGAAATCTC
AGACCTGGATTCGGACCTTCCCGTTACAAACCGAGCATCT
CGTCGCAAAGACCGAAAATCGAACAGAAACCGGGCTGATC
CTGTGTCGAAAAAACTTGAATCCCCTCCTCTGCGCTCAAC
TCTCACAAGACCTGCTCAGTCTATGCCTCCTCGCAGAGTT
CCCTCGGAGTCTGAATCTGATCGCAGCAACTCTCCTCCAC
CAAGACATGACACTCTCGATCACAGAAACAAGGTTCTCTC
TGGGTACTCCACACTGCCAAACCCTCGAGCTTCACCCATC
ACCTCCTCCTCCACATCCCGGCCTCGCAGAGCCGTTTCTG
AGTCAGATTCAGACCGGAGCGCATCTCCACCGCCCAGACG
TGAGAGTCCCAGACCTGATAACCACTCCAGATACAAGGTG
CTTCCTGATCTCCCCCCTCCAGGTTTGAAGCCTTCTTCTC
TTAGCATGTCTCAGGATTTCCCTCGCCGCATGGCTTCACC
TTACAGGCCTCCACCTAGAGATGCTTCAGAGTCTGAATCG
GACGAAAGTGCCAGACCTCAGCGCAGACAGGGGACTCCGG
CCAGCCAAGAGTCCCGCAATAGATACAGGTACACATGAGG
GACGCCTCACTGCCACTTTTTACCCAACTCCCATCGGGCT
CTTTCTGTAGGGCCGACCATCATCCTGCATACGATGACAA
AGAAACGTTCAATGTTGTTTTTGATTCATTTCGATTATGT
TGCTTGTATACGTTCATGTATTTCTGCTTCATTGTGTTCT
CTGGAAATGTGATATATGTGTGTGCTTTTAAAAATAAAAG
ACACCGAA

tjp3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tjp3-202 (1)    Ensembl 2861
tjp3-203 (1)    Ensembl 880
tjp3-204 1848
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tjp3-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045832 (1),  Ensembl_Trans:ENSDART00000147070 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH509347 (1) 976 bp
GenBank:EE699566 (1) 934 bp
GenBank:EE719664 (1) 903 bp
GenBank:EE703671 (1) 900 bp
GenBank:EH538786 (1) 880 bp
GenBank:EH559999 (1) 880 bp
GenBank:EH535454 (1) 849 bp
GenBank:EH471061 (1) 822 bp
GenBank:EH455770 (1) 819 bp
GenBank:CV484086 (1) 755 bp
CITATIONS (2)