Transcript

cfap74-004

ID
ZDB-TSCRIPT-100915-602
Name
cfap74-004
Previous Names
  • ch73-52n1.1-004
  • si:dkeyp-87a12.1-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044893 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044893|OTTDARG00000032181|ZDB-GENE-081104-480 cfap74|no_translation CH73-52N1.1-004 LG_ FP102465.4 Danio rerio protein_coding NOVEL, 621 bp
AGAAGCATAAAAAAGCTCCTGCACCCATCCATGGGAAAAA
ACAGCCGGGGAAACTCCTGCAGGACATACTATCTTCATCT
GAGCATACAAAAAGAGAGCAAAGGCATGAAGTGTTGAGTC
CCAGAGCGTCTTTTGTGAGCTCCCGCAGTGACAGCATCAG
CGAAGTCAGTTTCTCACCAGAGTGCGTGGAAATGAAGGAT
GAAGATGACGGAGACATGAGCCTGGCCCAGCCTGAGTTCA
CCGGCCTTTGGGAGCACAAACACACCGATTATATGGCCTC
GTCAGATGAAAATATTGAGCTTGAAACATCTCACACCACC
ATGAAGACCAAGCTGAACAAAAGTTCAGCTTCCAAAGCTG
AAAAAAAGACCGTAAAGAGCAGAGAATCAAAAGGACCACC
ATTCATCAGCAAACCGGAGGTTATTCTGTTCAAGTTTCGA
GCCACCGGGGCCCATGTCTGCTGGGATGGCTTGTGAACTG
GAGGCTATATTTAGACCCTCGGTAAGGTTTTTCACCGTAC
TATCATCAGCTCAGGAAGATATATCTCTGCTTCAGTCTGT
AGTCGCTGTTGTTGCTTCTTAAAGCGACAGTTCATCCAAA
AATAAATATTCTGCCATCATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations