Transcript

cfap74-007

ID
ZDB-TSCRIPT-100915-114
Name
cfap74-007
Previous Names
  • ch73-52n1.1-007
  • si:dkeyp-87a12.1-007
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045223 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045223|OTTDARG00000032181|ZDB-GENE-081104-480 cfap74|no_translation CH73-52N1.1-007 LG_ FP102465.4 Danio rerio protein_coding NOVEL, 847 bp
ATCGAAACAACGACAACTGACAACGGAGATGTTTGTGCGC
TCTCGCTTTGACACAGAAAGTTAACTAGGAAAATAAAGCT
GGTGTGGAGGTATGGATGTGTCGAATATTAGTGCAGATCT
GTCAACATCTTATAATAGTAACGTTAGTGGCCCACAGGAG
CACACAGACGTGGAAGGCACTTTGGAAGAGATCTTCAGAT
TTGAGGATGGTTTCTCTGATGGTTTCGACAGCTCTGAGTG
GGAAGTCAGTGATGGGGAAAATAAAACTGATGCAGACGGA
GAAATGCGACACACTGACAAGATACACACAATGAAGCTCC
AGAAGACTCTGGCTCAGCTAGACATGTTTTACCAGCAGAA
GAAGCTCAACGTGCTGCAGGCCAAGTGTGCATCCACATAA
TCATTATAAGTTTTTACCTCCTGTTATAACACGTCCACGT
TAAAGGTCCTGTGAAGAGCTTTAAAATGCGTGAAATTTAC
TGGATATTACTCATCTTAACTGAAACATGAAGAGAGGGTG
GGGCATAAAGTAGCTCCTCCCCTTTAATAAACAGCCAATA
GTGTATATTTTTTTCTCACAGCTCTGCTAGTGAAAGGGGT
TGAGCTCAAGCGCAGCAAGCCAATGAGAAGAAGGGTGTGG
GGCATGTCAGACACTACAGAGCATTTGATTGGACAGAAGA
TTTAATGAGACACTGAAGTATGAAAAAATTGTTGACGAAA
GTGACAAACTGCAAACTTTAGATGTTTATATCAGGTTTAT
ATCTACTAAACGTAAATATTGTCACTGTTTTAGAGCACAC
TAGATTATAGATATCTTTAAAACTCACAGACTGAAACTAA
CATCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations