Transcript

cfap74-005

ID
ZDB-TSCRIPT-100915-1117
Name
cfap74-005
Previous Names
  • ch73-52n1.1-005
  • si:dkeyp-87a12.1-005
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044894 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044894|OTTDARG00000032181|ZDB-GENE-081104-480 cfap74|no_translation CH73-52N1.1-005 LG_ FP102465.4 Danio rerio protein_coding NOVEL, 574 bp
CACATGAGACTCTGCATGTGGAGCTGCGCGGTTTAGCCGT
CAGACCTGCATTACTGCTGATCTCTGAGAGCGGACACAAC
ACCCTCCACTTCAGGACTCTGGCAGTCGGTCAGAAGGTGG
TGAAAAAGGTGATCATCCAGAACATTTCCTCACAGACAGT
AACCCTGTCTTCATCACTGCTGGACGTGAACGGGCCATTT
TCTGTGCTGAACGCCATGAGGTCCATCGCTCCTGAAGACA
AACACACACTCCTGATTGCTTTTACACCTTTATTGGCCAA
GAAGTACTGTGAGACTCTGGAGGTGAGCTGCAGTCAGATG
ACACTGGAGCTGACACTGCTCGGCGAGGCTGTCGATCCCA
TCATCACCTGCTCTCATGAAGGGCTCCTCGACTTCGACTG
GGTTCCTGAAAACGAGAGCACATCACAAGTGTTCAGGCTG
CAGAACGTCTCCTCTGTGGATGTGCAGTTCAGTGTGCTGC
TAGAAAGCCTGTGTCCGAGCGAACAGAAACTGAGCTCCAC
TGCTGCCGTGGCAGGGGGCGTCATCAGTCCTGCTGGAGCC
GCTGACATTACCGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations