ZFIN ID: ZDB-TSCRIPT-100915-497
Transcript Name: tmie-201
Previous Name: tmie-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047382|OTTDARG00000033660|ZDB-GENE-061207-9 tmie|OTTDARP00000037228 tmie-002 LG_none CU929426.5,AL929518.17 Danio rerio protein_coding KNOWN, 827 bp
GTTTCGTCCAGGCTGAAGGAAGGGGAGGGATGAGACGCGG
GAGAAGAAGAGGGAAAATGGCGATGGAGGGGCCTGGGAAT
CAGCCGCCATCCCTGGTCCCTTTGCTGATGAGCGTAACGG
CGGTGTTGATCTCACATCATTTCTTTAACGCGGCGGCCCA
GATACCAGACCCAGAGCTCCTGCCAACAGACCCTCCGAAA
AAGCCAGACCCCGTCACCTCAGAAACAGTGGTGTTTTGGG
GACTTCGATTATGGCAGGTTGTGGGCATTTTCTCCATGTT
CATCTTAGCAATAATAATTACGCTCTGCTGCATCTTCAAA
TGCCGAATCCCACGGACGAAAAAAGAGATCGAGGCTCGGC
ACGCGCAAAGACTTGCTGCGAAAAATTATGCCAACACACT
GGAGACGGTGCCTCCTCTCAATGAGCTGACTGAGGTGCCC
GGCGCTCTCGTGGAAACCTCAGCACTCCTGACGGTCTCAG
AGCAGGTACAGGCTCACGCTAGCGGACAACTTCCTGCTGT
CAGGGAAGAAGATGAACCAGCCAATCCTGGCACTTAAACT
GACGAACTCTTACTGTCATGTGCACTTGCTGCTCTTTCTG
CCTGTCTGTCTTCAGTCTGCGGTGCCTCAGAGTAGAAAAG
CCTATGCAGGCTATTTATGGGGAAGGTGGTGAAATGTGCT
GCATGCAGTGTTCTTGTTTTGCCTGCCATTAGAATCTGCT
GTCAGTAGAAGAAAGTCGCAAGTATGAATGTGAATCTTTA
GAAAAATTCCGACTTGAGTGCATCTCGGTTAATATAATGT
GATGAACGATTAAACAGCACACATCTT

tmie TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmie-201 827
tmie-202 (1)    Ensembl 696
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmie-201 Contained in:
[BAC] CH73-264D1 (1), CH211-163F10 (1)

Genome Resources: Vega_Trans:OTTDART00000047382 (1),  Ensembl_Trans:ENSDART00000101038 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH440140 (1) 856 nt
GenBank:EH580998 (1) 810 nt
GenBank:CR930010 (1) 539 nt
GenBank:GQ389649 (1) 528 nt
CITATIONS (2)