ZFIN ID: ZDB-TSCRIPT-100915-1011
Transcript Name: tmie-202
Previous Names: tmie-001, ottdart00000047383

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047383 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047383|OTTDARG00000033660|ZDB-GENE-061207-9 tmie|OTTDARP00000037229 tmie-001 LG_none CU929426.5,AL929518.17 Danio rerio protein_coding KNOWN, 696 bp
ATGAGACGCGGGAGAAGAAGAGGGAAAATGGCGATGGAGG
GGCCTGGGAATCAGCCGCCATCCCTGGTCCCTTTGCTGAT
GAGCGTAACGGCGGTGTTGATCTCACATCATTTCTTTAAC
GCGGCGGCCCAGATACCAGACCCAGAGCTCCTGCCAACAG
ACCCTCCGAAAAAGCCAGACCCCGTCACCTCAGAAACAGT
GGTGTTTTGGGGACTTCGATTATGGCAGGTTGTGGGCATT
TTCTCCATGTTCATCTTAGCAATAATAATTACGCTCTGCT
GCATCTTCAAATGCCGAATCCCACGGACGAAAAAAGAGAT
CGAGGCTCGGCACGCGCAAAGACTTGCTGCGAAAAATTAT
GCCAACACACTGGAGACGGTGCCTCCTCTCAATGAGCTGA
CTGAGGTGCCCGGCGCGGCAAAGGTTGAGGTGAAGGAGGA
GGTGCCAACCGTCGCAGGAAAGGTGGACGGAGAAAAGGAG
AAAAAGAAGAAAGAAAAAGAGAGCAAAAAGGAAGGCAAAG
GTGCAAAAGAAGGTAAAGAAGAGGAGAAAGAGGAACCCGC
AAAAAAGAAAGGAGAAAAGGGAGAAAAAGGGGAGAAAGGA
GCACCAAAGAAAGAAGCATCAGACGGAGGGAAAGGTAAAA
AAGGAGGAGAAAAAGCAGAGGAGAAAGGAGGTGCCAAGAA
GCCTGCGAAGAAATGA

tmie TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA tmie-201 (1)    Ensembl 827
tmie-202 696
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmie-202 Contained in:
[BAC] CH73-264D1 (1), CH211-163F10 (1)

Genome Resources: Vega_Trans:OTTDART00000047383 (1),  Ensembl_Trans:ENSDART00000129354 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:GQ389648 (1) 696 nt
CITATIONS (2)