Transcript

sat1a.1-204

ID
ZDB-TSCRIPT-100915-223
Name
sat1a.1-204
Previous Names
  • sat1a-003
  • sat1a.1-003
  • ch1073-228p2.1-003
  • zgc:114142-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046251 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046251|OTTDARG00000032997|ZDB-GENE-050913-41 sat1a.1|OTTDARP00000036497 CH1073-228P2.1-003 LG_ CU571090.9 Danio rerio protein_coding KNOWN, 896 bp
ACAGATGAACCGGAGCTGCTGCATGTGTGTCCGAGCAGAA
AGCAGATCTCAGACCTGTAGCTGAGGGTGAACCTCTGAGA
AGCGGATGAAGAAACAAATAATTCTACACTTCACATACCG
AGGACTAGTCAGCAAAGGAAAAAAGAGCAAGAGAAGAAGA
AGAAAATGGCCAGTTATATATTACGGAAAGCCGAACCCAA
GGACGTGTCTGACATACTGCGACTCATAAAGGAATTGGCG
AAATTTGAGGAAATGGAGGACCAAGTTATTCTCACTGAAA
AAGATCTGCTGGAGGACGGTTTTGGAGATCATCCTTTCTA
TCACTGTATGGTGGCTGAAGTGGCCAAACAGCATCAGAGC
GCCGACGGCTACAGTCTCTTGCTTCGCCATGTACATTGCT
CATGGCGTGTACATGGATGGGCGGGGAGGTAACTGAAAGA
AAGATCCGGTACAATAGTGTAACATTTACAGTAAAGCAGA
GGTCATGTGATCGTTGGCTTTGCCATGTATTATTTCACCT
ATGACCCCTGGATTGGGAAACTGCTCTACCTGGAAGATTT
CTACGTCATGAAGGAGTATCGGGGTTTCGGGATTGGGTCT
GAAATCCTGAAGAAACTCAGTCAGACGGCGGTGAGGACGC
GCTGCAGTAGTATGCACTTCATAGTGGCAGAGTGGAACAC
CACCTCCATTGAGTTCTACAAGCGGCGAGGAGCGTCCGAC
CTCTCGCACGAGGAGGGATGGAGACTCTTCAAGATCGACA
AACAGAGTCTCCTCAAGATGACCAGCGAGGAGTGAAGCGC
TCTGGAGGACCACCTGCTGTTCAGTTTAGTGGACACAACT
TTAAAAGTCATGGTGCATCTAAACACATGCTGCGTCCCAA
TTCGCATTCTATCCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations