Transcript

sat1a.1-002

ID
ZDB-TSCRIPT-100915-1252
Name
sat1a.1-002
Previous Names
  • sat1a-002
  • ch1073-228p2.1-002
  • zgc:114142-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046250 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046250|OTTDARG00000032997|ZDB-GENE-050913-41 sat1a.1|no_translation CH1073-228P2.1-002 LG_ CU571090.9 Danio rerio protein_coding KNOWN, 957 bp
ACAGATGAACCGGAGCTGCTGCATGTGTGTCCGAGCAGAA
AGCAGATCTCAGACCTGTAGCTGAGGGTGAACCTCTGAGA
AGCGGATGAAGAAACAAATAATTCTACACTTCACATACCG
AGGACTAGTCAGCAAAGGAAAAAAGAGCAAGAGAAGAAGA
AGAAAATGGCCAGTTATATATTACGGAAAGCCGAACCCAA
GGACGTGTCTGACATACTGCGACTCATAAAGGAATTGGCG
AAATTTGAGGAAATGGAGGACCAAGTTATTCTCACTGAAA
AAGATCTGCTGGAGGACGGTTTTGGAGATCATCCTTTCTA
TCACTGTATGGTGGCTGAAGTGGCCAAACAGCATCAGAGC
GCCGACGGTAAGAAAAAAAACTACATTGAGAGCACGATGT
GTTGTGTTGTTCTGCTTTTTTGTTTCCAGATCAGGTTGAG
CAAGCAAGAACAGCAGGAGAGTGTAAATACACACCAACAC
TTGGTTTACCAGCAGTGTTTCTGTGTGCAATGATGCAAAA
CTGTGTTTGGCAACACTTTGCATTGCAGTGTGCATGTTAC
ACAAACTATTAACACAAACTACTGTACATGCTGTTTACTA
GTAATGGATCAAGCTAACATCAATTGACTGTGTTTATACA
CGTAAATATAAATATATTTATTTTTTAAAAACGGATCATA
TCAAAGAGAACAGATACAAAAAAAAATTGTTGCACTTCAA
TAAATAAATAGGTAAAAATAAAGCAAAATAAATCAATAAA
TAAATATAAATACATAATAGATAAATGAAAAATATATATA
TATATTTTAAATATTTTATTTATTATTTATTTATTGAAGT
GTAACAACTTGTTTTGTGTCTGTTCCCTTTGATATGATAC
CCTTTTTAAAAATGCTGGGTTTTCTTTTACCGTTTTTGTA
ACTTTATACTCATAATGCATTTGAAATTTGGAAAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations