Transcript

sat1a.1-201

ID
ZDB-TSCRIPT-100915-737
Name
sat1a.1-201
Previous Names
  • sat1a-001
  • sat1a.1-001
  • ch1073-228p2.1-001
  • zgc:114142-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046252 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046252|OTTDARG00000032997|ZDB-GENE-050913-41 sat1a.1|OTTDARP00000036498 CH1073-228P2.1-001 LG_ CU571090.9 Danio rerio protein_coding KNOWN, 810 bp
ACAGATGAACCGGAGCTGCTGCATGTGTGTCCGAGCAGAA
AGCAGATCTCAGACCTGTAGCTGAGGGTGAACCTCTGAGA
AGCGGATGAAGAAACAAATAATTCTACACTTCACATACCG
AGGACTAGTCAGCAAAGGAAAAAAGAGCAAGAGAAGAAGA
AGAAAATGGCCAGTTATATATTACGGAAAGCCGAACCCAA
GGACGTGTCTGACATACTGCGACTCATAAAGGAATTGGCG
AAATTTGAGGAAATGGAGGACCAAGTTATTCTCACTGAAA
AAGATCTGCTGGAGGACGGTTTTGGAGATCATCCTTTCTA
TCACTGTATGGTGGCTGAAGTGGCCAAACAGCATCAGAGC
GCCGACGGTCATGTGATCGTTGGCTTTGCCATGTATTATT
TCACCTATGACCCCTGGATTGGGAAACTGCTCTACCTGGA
AGATTTCTACGTCATGAAGGAGTATCGGGGTTTCGGGATT
GGGTCTGAAATCCTGAAGAAACTCAGTCAGACGGCGGTGA
GGACGCGCTGCAGTAGTATGCACTTCATAGTGGCAGAGTG
GAACACCACCTCCATTGAGTTCTACAAGCGGCGAGGAGCG
TCCGACCTCTCGCACGAGGAGGGATGGAGACTCTTCAAGA
TCGACAAACAGAGTCTCCTCAAGATGACCAGCGAGGAGTG
AAGCGCTCTGGAGGACCACCTGCTGTTCAGTTTAGTGGAC
ACAACTTTAAAAGTCATGGTGCATCTAAACACATGCTGCG
TCCCAATTCGCATTCTATCCATCCTATATAGGAATGTTCC
AAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations