header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-196
Transcript Name: kng1-202
Previous Name: kng1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046151 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046151|OTTDARG00000011480|ZDB-GENE-041010-56 kng1|OTTDARP00000036426 kng1-002 LG_ BX005105.6 Danio rerio protein_coding KNOWN, 732 bp
AAGGCAATTTTTTGAAAAATATTAATATATTTACTTGACA
GACAGACATTATGTAACTTGCGGATCGTGTATGCATTTTG
CGGATGAATTGTTTTAACTGTGCTCAGACTCTTCTGTTCT
GTAATTTCCTTCAGGTTTGGCGTTTTGTGAGGTGCGTGGT
CAACTTTCTTTCCTCTGTGTGGATGTGAGGTAAAGGACGA
GGCATCTGAACTCACCCAGGCAGTGCAGAGAAGACAGCAT
CAGCAGGAGGACGGAGCGACTGGACTGGGTCATTTTAAAG
AAAGTATTACTGGTGGCAGAGTGGATGGTGTTTTGGCATC
AGCTGAAGCGCAGAGCTGAACTATAAAGCACATGTGTTTG
TTGAGGAGGATCTTCATGCTGACATAGTTTGACATCAGGA
AGCTGCTCTGAACGAGCTCATGGCGCAGAATGAATCGGGG
GACGTTTTGTTGGTGCGGTTTTCCAGCAGAGAGACTGACT
GTCCTGCTGGAGGAGAGAAGACTTGGCATGAGTGCGACTA
CCTACAGCAAGCAGATAAGGCTCTCAGGATCTGTCATGCC
AAAGTCCAGTTTACAGAAGCAGGAGAGGAGCTGCTGCTGC
ATGACTGTTTAGAGCCGGCAATCATCGCCAGCGTCGCTCC
TTGTCTGGGCTGTCCTGAAAATATCGATGTGCATAAGGAA
GAGCTGAGACAGCCGCTCATCCACTCTCTGTCCAAAGCCA
ACAGCATGATCA

kng1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kng1-201 (1) 1267
kng1-202 732
kng1-203 (1) 801
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kng1-202 Contained in:

OTHER kng1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046151 (1)
  • Ensembl_Trans:ENSDART00000137548 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT882487 (1) 734bp
    CITATIONS (2)