header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2494
Transcript Name: kng1-201
Previous Name: kng1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013380 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013380|OTTDARG00000011480|ZDB-GENE-041010-56 kng1|OTTDARP00000011425 kng1-001 LG_ BX005105.6 Danio rerio protein_coding KNOWN, 1267 bp
ATTACAGGGGTGGATAGAGTCCAGCAGGAGCGCTTCTGAA
CCCTTTCACTCCTCACACTGTTTTTTGGGGGGGTTCTCAG
AAGAGCAGAGATATTGGAGACAATGGCGCTGGACAAGAGC
TTGACGGTTTTGGCTATGCTTTGGCTTTATTTTTGTGGTG
GACTTGCACAGACAGACTCTAGCGTCCCGTGTGATGACAG
ACGAGTGGAAAAAGTGGTGAATTTAACTCTTGGGACACAT
AATAAAATGATCACCGAAGGAGCTCAGCTGGCTCTCTATG
AGATCCTGGAGGCCACCAAAGCGCAGAATGAATCGGGGGA
CGTTTTGTTGGTGCGGTTTTCCAGCAGAGAGACTGACTGT
CCTGCTGGAGGAGAGAAGACTTGGCATGAGTGCGACTACC
TACAGCAAGCAGATAAGGCTCTCAGGATCTGTCATGCCAA
AGTCCAGTTTACAGAAGCAGGAGAGGAGCTGCTGCTGCAT
GACTGTTTAGAGCCGGCAATCATCGCCAGCGTCGCTCCTT
GTCTGGGCTGTCCTGAAAATATCGATGTGCATAAGGAAGA
GCTGAGACAGCCGCTCATCCACTCTCTGTCCAAAGCCAAC
AGCATGATCAACCACGTGCATTTCTTCATCTTCAAGGACC
TGACGTCAGCAACTAAACAGGTTGTTGCAGGTTTCAGGTA
TAAACTGCAGTTTGAGATCGAGAAGAGCAACTGCACACGG
CCAGAGTTCAAGATAGTAACTGAGGAGTGCCATCCCCTGC
TGGAGAAAACGGAGGTTTTGAAGTGTAACTCGAGTGTGGA
TGTGGCTCCTTGGAGACATGAGGTTCCAGAAGTGCATGTT
GTATGTGAGGCAGGCGTCTCGAAGACCAACAGCAGGTTCA
AACGACCCCCAGGCTGGTCTCCTCTAAGGATGCTCCCACA
AGCCAAAGAGTCCTCAGAGGAATCCAAGGAGAGCATCAGC
CCCCCAAAACACGTCCCGCTGAACTGCCCAACCAAACCCT
GGAAAGAGTTCAAGCCGATCATCGCTCCACCAAACGCCAC
TGAGCCCTCAGAGCCGAGCGCAGACACCGCTCTCAGCGAC
CTGGATCTGATCAGATGAGCTCGGCGTTTAAATGAGGAGC
TGATCTAAAACAGGGGGAGAGAGAGAAGTCTATTAATGTG
TTTTGTGGAGTTGTGAATAAAGTGTCATTAGTTTCATTGG
TGGATTCGCCAGTAATTCACAGTACATTGTCTCATATTTC
ACAATAAAAGTGACAAATTTACAAATA

kng1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA kng1-201 1267
kng1-202 (1) 732
kng1-203 (1) 801
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kng1-201 Contained in:

OTHER kng1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013380 (1)
  • Ensembl_Trans:ENSDART00000029588 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083429 (1) 1229bp
    GenBank:CF594773 (1) 918bp
    GenBank:CK016764 (1) 843bp
    GenBank:CK142878 (1) 779bp
    GenBank:CK028924 (1) 775bp
    GenBank:CB364169 (1) 685bp
    GenBank:BI896275 (1) 635bp
    GenBank:BQ074380 (1) 585bp
    GenBank:AL928303 (1) 539bp
    GenBank:CB364871 (1) 493bp
    GenBank:CB354519 (1) 492bp
    GenBank:BQ074555 (1) 470bp
    GenBank:AI723139 (1) 456bp
    GenBank:AI496901 (1) 431bp
    CITATIONS (2)