Transcript

skiv2l-201

ID
ZDB-TSCRIPT-100915-117
Name
skiv2l-201
Previous Names
  • skiv2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045244 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045244|OTTDARG00000031726|ZDB-GENE-010430-5 skiv2l|OTTDARP00000035754 skiv2l-001 LG_none FP067438.3,FP102194.5 Danio rerio protein_coding KNOWN, 4191 bp
CGAGAAAGGAGGTCAAATTAATCGTTTGTCCATACTGAGA
TAATTTTAAAGTATCTATTATTTAAAGTGCACCAATACTT
TAGTGTGATTTAGATCACACACGTAGATCGTTAAATTATA
AAGCACAAAATAAAATAAAATGCATATACTTCCGTCCCAT
TACTTCTGCGCAGCTTCCTGTAGGACTGCCTGAAACTTTA
TTGAAACTGGAGAACTGCTGAGTGACATGGACAAAATAGA
TTTGCCCCCAGTGGGTCCTGATGACTTGCCCCTGTCTCTG
CTGGAGATGGGCTGTTCTGGGAGATTTGAGCTCATCACAC
ACACACTGCCCAAAAACAAACCCCTGCCTCCGCACAGCAC
TCTCCCACATGGACTGCCTCCTACTTGTCTGGATTTAAAG
ACAGAGGTAGAAAAGCGTTTTCTGCGAGATCCTGCTTGGC
TCCCGGTACATGATGTAGATGATGCCTTCAACAAGTTCCT
TAAGATAAGTAAGAGAGAAAAAGAAGTGGACTCTCTCCTG
CACTGCTCTCTGTCTCAACTGCATTCTGGTCTGTCTGTGG
TCAGAGATCCAACCACCGGCATGCTGCTGGATTTCACTGA
GGTGTTGTTAGAGGACACAGGTTTGTCTGCAAAAAATTCA
CTCTCGTTACAAAGACAGCCTGGACCTCCGTCAGAGAGTC
TGCGAGGGAGCAACACAAACTATCCATTTCTGCCAGCTGG
AATGGAAGAACTGACTTTAGAGCAGATCAAAAACAAGTCA
GAGCTGGAAGAAGACATTGACTTTGAGAAAGATTTGATGA
CAGTTCCTCCTGGGCTGAAGGCTGGTATGGACTTCAGTGA
CAAAGAAGCCAGAAACACGAAGAGTGAGGTGAACCTGCTG
TCGCTTCTGTCTACTTTTGATGATGTCCTTGATGCTCCGC
CAGAGGACAAAGAGGGAGTCTCACAAAAAGAGGAGATCGT
TAAACTTCCCAGAACTAACAGCCTGGAGGATCTGGGCATT
AAAGATTCGGGCAGCTCGCAGCCTCAAGGGAACACAGGCA
GTCTGACTGAACAAAAGAAGAAAAACCTGGAAGAAGAAAA
GGGAGACAATAAAAAATGGGCCATTCCGGTGGACATCAGC
TCACCGTGTGCTGACTTCTACAAACGGATCCCTGATCCAG
CGTTTAAGTATCCCTTTGAGCTGGACGTGTTTCAGAAGCA
GGCTATTCTCCGTCTGGAAGCTCATGACTCTGTCTTTGTT
GCGGCTCACACCTCAGCCGGCAAGACTGTGGTGGCTGAAT
ACGCAATTGCACTTTCCCAGAAACACATGACCAGGACCAT
TTACACCTCCCCCATTAAGGCCTTGTCCAATCAGAAGTTC
CGAGACTTCAAGAACACATTCGGTGATGTGGGACTTTTGA
CTGGAGACGTGCAACTGAACCCAGAAGGCTCATGTCTCAT
TATGACCACTGAGATTTTGAGATCGATGCTCTACAATGGC
TCGGAGGTCATCAGAGATCTAGAATGGGTCATTTTTGATG
AGGTTCACTATATCAATGATGCAGAGAGAGGAGTGGTGTG
GGAGGAAGTGCTTATCATGTTGCCGGAGCATGTTAGCATC
ATCCTGCTCAGTGCCACAGTGCCAAACGCAGTGGAGTTCA
GTGAATGGATCGGGCGCATCAAGAAGCGACATATTTACGT
GATCAGCACAATTAAGAGGCCTGTTCCTCTAGAGCACTAT
CTCTACACAGGCAACAGCACCAAGACTCAGAAAGAGCTCT
TCATGTTGCTGGACGCAACTGGAAACTTTCTTACTAAAGG
CTACTACGCTGCAGTGGAAGCCAAGAAGGAGCGCACTAGT
AAACATGCACAGTCTTTTGGCACAAAGAACGTATCGCAGC
ACAACACAACAGCCAGTCAGGATCGTGCGGTGTGGCAAAC
GCTGTTAAATTATCTGTCTCAGAGGCAGCAGACTCCAGTG
GTGGCATTTACATTCTCTAGGACACGATGTGATGAAAACG
CTCGCTCTTTGACCTCTCTGGACCTCACCACATCCATAGA
GAAGAGCGAGATCCACTCCTTCCTGCAGAAGAGCCTGACC
AGACTGAGAGGAGGAGATCGACAGCTACCACAGATCCTGC
TGATGCGTGATTTGTTGAAGAGAGGGATTGGTGTTCATCA
CAGCGGCATCCTGCCAATCCTGAAGGAAGTCATTGAAATG
CTCTTCTCCAGAGGTTTAGTGAAGGTTCTGTTTGCTACAG
AGACTTTTGCCATGGGTGTGAACATGCCTGCCAGAACTGT
TGTGTTTGACAGCATCCGCAAACACGACGGCACGGGATTC
AGAAATCTGCTGCCCGGCGAGTACATTCAGATGGCGGGTC
GTGCCGGCAGAAGAGGTTTGGATGCCACAGGAACTGTTAT
CATCCTCTGTAAAGCTGGAGTTCATGATATGGGAGAACTC
CACTCAATGATGCTGGGGAAGCCGACGGTGCTGCACTCTC
AGTTCAGACTGACCTACACCATGATTCTGAATCTGCTGCG
TGTGGAGGCCCTGAGGGTCACCGACATGATGAAGAGAAGC
TTCTCTGAAAACCACAGGGATACACAGGCTCACGAGAAGA
GAATAAGTGAGCTGAGAAACACGCTGTCTTCTCTTCCTCC
GCTGGACACGGAGGGGCAGTTGTCTGATTTACTGTCATAT
TACCACACAATCACAGAGCTGCACATCACCACACAGAGCC
TGCAGCAAGCTGTTCTGGAGTCAGTCAATGGTCTCAAAGC
TCTGTCTGTTGGAAGGGTGGTGATCGTGAACAACAGCCAG
CATCACAACTCTCTGGGAGTCATTCTACAGGTGTCCAGCG
ATGCAGTAAATCGCACCTTCACCGCTCTCATTATCTGTGA
GAAGGGTAACGAGGAGGCGGCCAGTGATGAGCAATCTAAT
AAAGTTGCACTTCCCATCTATAGCAAAACATTGTTTATTC
CTGAGGGACCCTGCAGTCATACTGTGCAGAAACTGAAGTT
GCAGGACATTTCTGCTATTACAACCAAAGCACTCAAGGTC
ATACCAGAGAGAATCATCGACAACTACAACAAAAGACTAC
AGCCACGCTTCAGGCTTGATCCACCAGGTCAAGCTATCTC
TACAGCAACCCAGGAGCTCCTTCGATTGGCTGAGGCAAAT
ATGGGTGGCATGACCGTCCTTGACCCAGTGAATGACCTTC
ACCTAAAGGGTGTTGATGTGGTGGAGGGTGTGATGAGGCA
GCGAGTGTTACAGGACTCTCTAAAAGACTTCCACTGTATC
CACTCACCCACCTTCTCTGAACAGTTTACACGTGTGCAGG
AGAGGATGAGTGTACAGGAAGAGCTTGATAAGCTTCTGTT
CCTGGTGTCTGATCAGTCATTGACACTTCTGCCTGAGTAC
CATCAGAGAATCAAGGTGCTGGAAGCGCTGCAGTATGTGG
ACAGCAGTGGTGCGGTTCAGCTGAAGGGTCGTGTGGCATG
TCAGATCAGCAGTCATGAGCTCTTACTGACTGAACTCCTG
TTTGAGAACACTTTGAGTCCTCTGGCCCCTGAGGAGAGCG
CCGCCCTGCTGTCCTGCCTCGTCTTCACACAGAACACCCA
GATAGAGCCACATATCACCAACACACTGCAGGAGGGAATC
AATCAAGTTCTCGCTGTAGCCCAGCGTATCGGTGACCTGC
AGAGGGATTGTGGGATTGCTCAGACCGCTGAAGACTTCGT
GGCCCAGTTCAAGTTTGGCCTGACTGAGGTTGTGTACTGC
TGGGCAAGAGGAATGCCATTTGCTGAGATAGCCCAGCTGA
CAGATGTGCAGGAGGGAACAATCGTGCGCTGTATCCAGAG
GCTGGACGAGGTCCTGAAGGAAGTCCGACAGGCTGCTCGC
ATTGTGGGTGACTCTGTCCTGGGCAGTAAGATGGAAAGAG
CCTCTCTGGCCATACGCAGAGACATTGTGTTCACCGCCTC
GCTCTACACACACTGAAGCAGACAGACACAAACACACTGT
TTGGAGTGGGGTATAATTATAGTGTACAGAACATGGACCT
TCAGAACTGTACTTGAACTTCTGAGTGCATGTTTACACTG
AGTGTGCACGTGCCTCATAACAGACCAAATTGTGACCTCA
ATATGAAATGGAGGTTGAGACCAGAAATGAACTGTAATTA
AGTATACAGCAATAAAATGAGCTGAGTCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations