Transcript

ottdart00000045245

ID
ZDB-TSCRIPT-100915-630
Name
ottdart00000045245
Previous Names
  • skiv2l-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045245 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045245|OTTDARG00000031726|ZDB-GENE-010430-5 skiv2l|no_translation skiv2l-002 LG_none FP067438.3,FP102194.5 Danio rerio protein_coding KNOWN, 789 bp
AAAATGGGCCATTCCGGTGGACATCAGCTCACCGTGTGCT
GACTTCTACAAACGGATCCCTGATCCAGCGTTTAAGATAT
TGTGCAAAGCTGGTGCACATGATTTTTGTCAGTTTGTTAA
AATTTATGCTTGTTTTTGGTCTATTCTTGCTTCCTATCAG
TATCCCTTTGAGCTGGACGTGTTTCAGAAGCAGGCTATTC
TCCGTCTGGAAGCTCATGACTCTGTCTTTGTTGCGGCTCA
CACCTCAGCCGGCAAGACTGTGGTGGCTGAATACGCAATT
GCACTTTCCCAGAAACACATGACCAGGACCATTTACACCT
CCCCCATTAAGGCCTTGTCCAATCAGAAGTTCCGAGACTT
CAAGAACACATTCGGTGATGTGGGACTTTTGACTGGAGAC
GTGCAACTGAACCCAGAAGGCTCATGTCTCATTATGACCA
CTGAGATTTTGAGATCGATGCTCTACAATGGCTCGGAGGT
CATCAGAGATCTAGAATGGGTCATTTTTGATGAGGTTCAC
TATATCAATGATGCAGAGAGAGGAGTGGTGTGGGAGGAAG
TGCTTATCATGTTGCCGGAGCATGTTAGCATCATCCTGCT
CAGTGCCACAGTGCCAAACGCAGTGGAGTTCAGTGAATGG
ATCGGGCGCATCAAGAAGCGACATATTTACGTGATCAGCA
CAATTAAGAGGCCTGTTCCTCTAGAGCACTATCTCTACAC
AGGCAACAGCACCAAGACTCAGAAAGAGCTCTTCATGTTG
CTGGACGCAACTGGAAACTTTCTTACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations