Transcript

sdk1b-203

ID
ZDB-TSCRIPT-091203-315
Name
sdk1b-203
Previous Names
  • sdk1b-002
  • rp71-86k19.1-002
  • si:rp71-86k19.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045767 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045767|OTTDARG00000029833|ZDB-GENE-090311-17 sdk1b|OTTDARP00000036115 RP71-86K19.1-002 LG_none BX323020.9,BX323995.14,CU468965.4,CU929103.7 Danio rerio protein_coding NOVEL, 935 bp
ACACCGCTCCGTACTTTAAAACGGAGACAGGAGGAGCACA
GACACACCTGGAGGGGAACAGACTGGTGCTCACCTGTCTG
GCGGAGGGCAGCTGGCCACTTGAGTTCAAATGGATGAGAA
ACAGCACAGATATTACTGAATACACACCGGAGTACAGGTA
CACGATCGTGTCTTTAAAGCGTGAGGATGCGGGTGTGTAT
CAGTGCGCGGTGAGGAACAGGATGGGAGCGCTGATCCAGA
CGAGAGCCGATGTTCGTGTGGCTTACATGGATAATTTTGC
TGAACTGGAGCAGAGAAAGACGGTCTCTCAGGGAAGAGCT
GCTGTCCTCAATCCTCCTGCTGTGACCAGTTTTCCTCGGC
CTCAGGTCACCTGGTTCAGAGACGGTGTCAAGATCATCCC
GAACCATCGAGTAGCTATAACGTTGGACAATCAGCTGGTG
GTGTTGAGTACGGCAGCGGCAGATGCAGGGCGCTATTATG
TACAGGCTGTTAATGAACGTAATGGGGAAAACAAAACCAG
TCCTTCCATTTACCTGAGCATAGCAAGTAAGTTGTTTTGT
CATTCATACTGTTTTGCTGTATTATTTAAATATATGTAAA
TGTGCGCGTGTGTGTGTGTGTGTGTGTGTCTGTACATGTG
GCTAAGTTAGTGAAATGTCTTGTAGGCCTACATTTTAAAG
TAGTTATACATGTTTCAGGCAAATTAGTCATTTTTTGTGA
TAGTGTGGTGTACAGTTTTTGGACACATTGGACTGATTGT
GTTTTGTCTGTTGTGTATTTCACTTTACATTTGCTATTAA
GGTGGTATGTTACAAATACAGAATGAGTGTATGTGTTACA
AATGCAGTTGTGTACATAAATATATTGGCGCTGGGCGACA
TGCTATTGATCAGAGCCAAAAATAAAGTTTATGAAGTATG
CTACACGCACACATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations