ZFIN ID: ZDB-TSCRIPT-090929-21140
Transcript Name: sdk1b-202
Previous Names: sdk1b-001, si:rp71-86k19.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000041055 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000041055|OTTDARG00000029833|ZDB-GENE-090311-17 sdk1b|OTTDARP00000032797 RP71-86K19.1-001 LG_none BX323020.9,BX323995.14,CU468965.4,CU929103.7 Danio rerio protein_coding NOVEL, 6642 bp
AGACACCGCTCCGTACTTTAAAACGGAGACAGGAGGAGCA
CAGACACACCTGGAGGGGAACAGACTGGTGCTCACCTGTC
TGGCGGAGGGCAGCTGGCCACTTGAGTTCAAATGGATGAG
AAACAGCACAGATATTACTGAATACACACCGGAGTACAGG
TACACGATCGTGTCTTTAAAGCGTGAGGATGCGGGTGTGT
ATCAGTGCGCGGTGAGGAACAGGATGGGAGCGCTGATCCA
GACGAGAGCCGATGTTCGTGTGGCTTACATGGATAATTTT
GCTGAACTGGAGCAGAGAAAGACGGTCTCTCAGGGAAGAG
CTGCTGTCCTCAATCCTCCTGCTGTGACCAGTTTTCCTCG
GCCTCAGGTCACCTGGTTCAGAGACGGTGTCAAGATCATC
CCGAACCATCGAGTAGCTATAACGTTGGACAATCAGCTGG
TGGTGTTGAGTACGGCAGCGGCAGATGCAGGGCGCTATTA
TGTACAGGCTGTTAATGAACGTAATGGGGAAAACAAAACC
AGTCCTTCCATTTACCTGAGCATAGCAACAGACGTTATTG
CCCCAGCTGAATTGGTTGCCCCAGTGATAGTGATTGCACC
TAAGAACACATCTGTGGTTGCGGGGGCGAGTGAAGCCACT
CTTGAGTGCGTCGCTAATGCAAGATCTCTTGACAGGCTGC
AGGTGTTCTGGAAGCGTAATGGGGTGAGACTAACAGCAGG
AGTGGACTCGTTCGGTCGCAGGCTGGTCATCAGTAACCCC
ACTTCAGCAGACGGCGGTCTGTACGTGTGCGAGGCCACGC
TCAGAAACAGCAGTCAAAAGAGCACAGAAGCCAAAGCATA
CCTCTCTGTTCTGGAGTCTCCACACTTCACATCAAAACCA
AAGAGGTATATGATTGCGGAAGTTGAAAAAAATGTGGAAC
TTCAGTGTCATGCCAAAGGGGTTCCCACACCGAAGCTGGA
GTGGTTCAAAGATGCCATCCCGCTCTCCACACTCAACAAC
TCTCGATACAAGCTCACCACCTCCTCAATGGTTCTTCAAG
TGCGGAGAATCCAACCAGACGATGCCGGAATATTTCAATG
CTTTGCTGAAAACACAGCAGGAGAAATCCAAGCACACACC
AACCTGGTCATCACAAGCATGTCACCATTGTTTACCACGC
CCCCTTCTGACATCACGGTGACTGACGGTACATCAGCTGT
GTTCACCTGTGATACATCCGGTGCCCCCAAACCTGCCATC
GTCTGGAGGAAAGGATCTCAAGTGTTAGCGAGCGGATCGG
TGCAGACGCCTCGTTTCACTCTGCTGGAGTCCGGAGGCTT
ACAGATACTACCCATAATGCCAAGCGACGCAGGGAATTAC
ACATGCCTGGCATCGAACACTGAGGGACTGGTCAACGCCA
CCGTGGCCCTGACAGTTTTAAGTCGAACCTTCATCTCCAC
ACCCCCTGAGGATCAGCGTGTCATCAAGGGAACCACCGCT
GTACTGCACTGTGCAGCAACCCACGATCCCAGAGTCACTG
TCAGATATTCATGGAAGAAAGGAACCAAGCCGCTGAGCGT
GTCGACTGGTGGGCGAGTGTCAATGAAGGAGGGTTCACTC
CAAATCAGCCAGACGTGGTCCGGAGACATCGGAGACTACA
CCTGCAGGGTCATCTCACCAGCTGGGAATGACTCCAAAAG
TGCCCGACTGGAAGTCATAGAACTTCCACATTCTCCACGC
AACCTTCAGGTGGCTTTAAATGAGACTGACAGCAGGACGG
TTCTTCTGTCGTGGGTTCGACCATTTGATGGGAACAGCCC
TCTCCTGCATTACATCATTGAGTTCTCTGAGAACAATTCT
CCGTGGAAGGTCTACATGGATGATGTTAGTCCTACACTAG
CCAGTTTGCTAGTAATTGGTCTAACACCAGCAAGAACGTA
CCAGTTCAGAGTGTGTGCTGTCAATCAGGTGGGACGTGGA
CAGTACAGCGCTGAAACCAACAGGCTGATGCTGCGAGAGG
AACCGCCCAGCGCGCCTCCAAAAAACATTGTGGCCAGCGG
CCGTACCAACCAGAGCATCATGGTCCAGTGGCAGCCACCG
CCAGAACCGCAGCTTAATGGAGTCCTGAGGGGATACGTGC
TCAGGTACAGGCTGGCGGGTCTGCCGGGTGAGTTCCAGCT
GAAGAACATCACCAGTGCAGAGATTAATTACTGTCTGATT
GGAGAGCTCATCATCTGGACGCAGTACGAGATCCAAGTGG
CTGCCTACACTGGAGCGGGCCTGGGGGTGTACAGCCAGTC
TGCCACCGAATACACACTGCAAGGAGTGCCCACAGCGCCC
CCTCAAGACGTGGAGGCTGTAGCGCTGAATTCAACCACCA
TCAAGTTCACCTGGACGCCTCCACCACAGCAGTTCATCAA
CGGCATTAACCAGGGCTACAAGCTGCTGGTGTGGCCTGAA
CACTGTCCGGATTGCATTACAATGGTGACCATTGCCCCCG
AGTTCCACGGGTCACGTCATTATGGTTATGTTAGCAATTT
AAGAAAGTTCACGTGGTATGAGACAGCGGTGCTTTGCTTC
ACCACTCCTGGAGATGGACCGGCCAGCACATCACAGCTCA
TCCAGACACATGTTGACAGTCCAGTGACTCAACTGAGCTT
CACTGAGATTCTGGACACATCTCTGAGGATCAGCTGGCAG
GAACCAGAAGACAAGAATGGCATCATAACAGGTTACGTCT
TGAGCTGGCAGGAGGCTGGTCAGAACGAAACGCTCGTATC
TCAGACTCTGTCCAACTCGACGCTGGCGTACAAAGTGACC
GGGTTGACTTCTCTCACCACGTACGCTCTACAGGTGGCAG
CAGTAACACAAGCTGGAGTCGGGGCTTCCACCTCATCCAC
CATCTCAACAGGACTGCCTCCAGAGCTTCCTGGTGCGCCC
TCTAATCTGGTCATCTCCAACATCAGTCCTCGCTCTGTCA
CCATTCAGTTCAGCCCTGGCAGTGACGGCAAAACCGAAAT
CTCCAAATGGATCGTAGAAGGACAGGTGGTGATTGTGGGT
GAGGAGGAAAAGGAGGCAGAATGGAAGGTTTTATATGAGA
GAGACAGTCCTCCAGCCTCAGACACACTGGAGATTCCCAA
TCTCATCCCCTTTACTCAATACAGGTTCAGAATGAAGCAG
GTGAACATTGTTGGTTCGAGCCCCTTTAGTGAGTCCTCCC
GATTGATGCAGACCCTGCAGTCCAGTCCAGATGTGGCCCC
GACTGAGCTTGTCGTGTTTTCAGCCAGTGAAACCAGCCTG
AGGATTCGCTGGGAGCCACTTCCAGAGGCGGCTTATAACG
GGAATCCTGAAAGTGTGGGTTATCGTGTTCGAGCACAGCG
AGCGGATGGGTTTGGGCAGCCCCGTATGGAGACTGTTTCT
GATCGCTTATCCTGTGAGGTGACAGTAGAGGGACTGGAAG
AGTGGACGGACTATGAGCTGAGCATTCAGGCCTTCAACAG
TATCGGGCCTGGACCATGGAGCAGTCATGTACTGGGCAAA
ACCAAAGAGTCAGTTCCCTCTGGTGCTCCGGAGAATGTGA
GCGCAGAAGCAATGAGCTCCACGAGTGTATTGGTCACCTG
GGGTTCGGTCCCTGAACACCAGAAGAATGGACACATCCTT
GGTTACAAGGTATTATACAGAGAAAAAGATTCTGACCGGG
CTCCCCAGGCCCACCTGGTGAACGGGAACCAGACCCACAT
GCTTCTTTTAAGAAACCTTTCCAAGTTCACAGTGTATGAG
ATCCAGGTGCTCGCATTTACACGTGTCGGAGACGGACCCC
CCAGCCTCCCCCCCACAGCTGAGAGAACCAAGGATGACGT
TCCTGGTCCACCTGTCAGGCTGATGTTTCCAGAAGTGCGT
CTCTCGTCTGTCAGGGTCGTCTGGCAACCTCCGTCTGAGC
CCAACGGCATCATTATGGGTTATCAGATTTCTTACCGTCT
TGATATCAACGACCCCAACAAGTTCACCACGGTTGAGGTG
GGCTCCAACGCCCGGCAGTTCACAGTCACGGGTCTGATGC
CAGAGTCTGCGTATGTGTTCCAGATCACGGCGCGCACTTT
ACAGGGCTGGGGGCCCGCAGACGAGGCCATCGTCATCACC
ACTGAGAAAAGAGAGCGTCCTCAGGCTCCGCGCCGGCTCA
CCGTGCCTCAGAAAGGGGTGGAGTCTTACAAGCTGCGACT
TCATTGGATGGCAGGCGGAGACGGCTCTTCCCCAGTGCGC
TACTTCACCCTGCAGACGCTGGAGCTGCCGGACGGAGACT
GGAAGACCCACACATCCTCCATCCCTCATAATAACTCCTC
CTGGGAGGTGGATAGGCTGAAGCCATACACCTCTTACAAA
TTTAGAATGATGGCTACAAATGATGTGGGAGACAGCGCCT
TCAGCAAAGAAACAGAGCCAGTTACCACTCTGCAGGATGT
TCCAGGTGAAGCTCCTGTCATTTTGCTTGTCAAACCTTCA
ACCACCACATCTGTGATTGTCCAGTGGCAGCCGCCTGCGG
AGGGAACTGTCAACGGGATTCTTGTGGGTTATCGCGTGTA
TTACCGCGAACTTCCAACTAAGAGCACATTCAAGACAGTG
AGCAGCCCTTCATTAACGGAATTTGAATTAACGCGTAACA
AGTACAGAAGATACGCGATTGTCATGACAGCATTTAATGT
TGTTGGAGAGAGCCCTTCAAGTGCACCTGTAGAGGTGTTT
GTGGGAGAAGCAGCTCCGTCAGTGGCTCCTCAGAACATTC
AAGTGAAGTCAGTGTCCTCCAATCAGCTGGATGTGGAGTG
GCAGCCTCCACCTGTGGAGACGCAAAATGGAAATATTCAG
GGATACAAGATCCATTACTGGGAAAAGGACCGGCAGAATG
AGACGGAGAAAGAGCTGGTTCTGTTTGTTCCAGAAACATG
CGTGCACCTGAAGAACCTGACATCCTACACTAGCTACCTG
GTGCAGCTCTCTGCGTTTAACGCGGCAGGAGACGGGCCAC
TCAGCACCGCCCGTAAAGGACGAACCCTGCAGGCTGCTCC
TGGATCCCCCAGCCGTGTGGTGTTTTCGGAAGTGACAGGA
AGCTCTCTGAATGTGTCGTGGGGGGCTCCTCTGCAGCCCA
ATGGAGTGTTGGAGGGATACAGAGTGATGTATGAGCCCAC
CGCTCCTGTACATGGAGTCAGTAAGACAGTCACGGTGGAC
ATCAAGGGGAACTGGCAACGCTGGCTGAAGGTTCGAGACC
TGATGAGGGGTGTCGTCTATCGCTTTAAGGTTCAGGCCAG
GACCATTAGTTATGGACCCGAGCTGGAAGCCAATATCACC
GCAGGACCAGTGGAAGGCTCCCCCGGTTCACCTCTGCAAA
CCTCAGTCACGAAGTCCGCATCAGCTCTGACACTCCATTG
GACGAAAGGCTCGGAAGGGGCGGGGCCTGTCACAGGATAT
GTCATTGAGGCTCGTCCATCAGATGAAGGATTATGGGATA
CATTTGTCAAGCATCTCCCAGCTGGCAGTCTCTCATACAC
CATCAGTCTGGATCGCCTGCGTTCTGGTGTGGCCTATGAA
TTCCGCGTCATCTCCGTCAATCGCTTCGGCTACGGCGATC
CCAGTCCACCTTCAACTGCGATGTCTGCTCTGTCTGAAAC
ACCTTTCTATGAGGAGTGGTGGTTCCTGATCGTCATGGCC
CTCATCAGTCTGATTCTCATTCTGATGGTTGTGTTTGGTT
TGCTCCTGCTCGGACAGAACAAGAAGTACAGGAGCTGTGG
GACAGGGAAGCACATCAGTACTGTCGAAGAATCGGTGACC
CTTGACAATGGCGGCTTCACGGCCCTCGAGCTGAACAGCA
GACATCTGAACGTGAAGAGCTCTTTCCTCAAGAAGAATGG
AACAAGGTCTCCTCCACGGCCCAGTCCGGGTGGGCTGCAC
TACTCTGATGAAGACATCTGCAACAACTACAATGGGGCAG
TTTTAACAGAGAGCACAACACTCACAGAGAAACCCACTGA
GCTGTCTGAGTCTGAGGTGAGCGACAGCGACTATGAAGAC
GAGCAGCCCAAACATTCATTCGTAAACCACTATATGAGCG
ACCCCACCTATTACAACTCTTGGAAGCGACAACCCAAAGG
CGTGAAGACTGGAGGCGGTTATGAGGAATGCGCCATGACG
GATGCAGAAGGGGGGTATTACCAGACTGTGGTGACCCAGC
ACAGCGTAGGGGGTGTTTATACCCCAACAGGGCAGCCCGC
AGCAGGAACGCGCACTCCAGTCACCGGCTTCTCCTCGTTT
GTCTGATGAACCAATGATGAAAAGCTGATGACTAGAGCCC
AGAAAATGGGACCAAACAATTGGGAGGGCTTTATCCTGGA
TAACAAAGTCTCTAATTTCCCCCCGAAATGTGGAGTTTAG
GGTTATGAAGTATCTTCTTGTGAACATGTTAATGATTTTT
GGATGGATTAACTATGATTCAGAGGAAGCGAAGACTTTGC
ACTGTGAGACTCTTCACGGAGAGAGATATTCATTTGGTAT
TCAAGACTCAAAGAAAGACGGATGAAGGAAATTCGTTCGC
TGTTCCATAACAATGTTCCCTGGATTAGCGGTGAACGCGT
GGGCAAACACACGCTTGAGTGATTCAATGAATCTCACTCT
GA

sdk1b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sdk1b-202 6642
sdk1b-203 (1) 935
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sdk1b-202 Contained in:
OTHER sdk1b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000041055 (1)
  • Ensembl_Trans:ENSDART00000141238 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN173817 (1) 874bp
    GenBank:AL924734 (1) 537bp
    GenBank:EB937631 (1) 456bp
    CITATIONS (2)