Transcript

fzd10-001

ID
ZDB-TSCRIPT-091203-163
Name
fzd10-001
Previous Names
  • ottdart00000045626
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
OTTDART00000045626 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045626|OTTDARG00000032635|ZDB-GENE-990415-220 fzd10|OTTDARP00000036018 fzd10-001 LG_ CU914776.10 Danio rerio protein_coding KNOWN, 2982 bp
GGCGGAGGAGCTCAGACACAGACAGCGCGCGAGGCAGAGA
GCTGCTCTTCAGGGAGAAACGGACACGAGCTAAAGTGAAT
ACTCACACGTTTACGGAGAGGATTCGTTCATTCATTTAAC
ATGACTGCGATGTAACGACACCGTGCCTTCCGTTTGGTCA
GTTTGGATACACTTTGCGGAGGATGTGTGTGTGTGTTTAA
AGTAGCGCGGGAGCTATTTGAAAAGTAAGTGTACTTTTGT
GAAGAAACAGACCGTCAGCGATGTTTCACAGAACTGGAGA
GATTTAAAGTACGGGTATATCATCTGTGGACTGGGAATTG
AACATTAACAGCGCGAAACCTCTCAAAATAGTGAAAGTTT
TTTTCATTTTTTTTCATCTGTTTGAAGATTTTTACGCACT
AAATTCTCCTGTTACTCTTTTTTGGGATATAATAACTTTT
TAAATTAAAACTAAAACAACAATGAAGAAACTTTTCTAGT
GAAACAAAGCTTTTCGGAGAACAATATCTGCTATACATGA
GTTAATATTGAAAGACAATGTTTGCTGCCGGTGTCGGACT
CAGCCTTGGGCTGCTGTGCTTTGCTGGGTTTTGTTCTGCG
ATCAGTTCCATCGACCCGGACCGGCCAGGTGAAGGAAGAT
GCCAGGAGATTGCCATTCCTCTCTGTAAGGACATTGGCTA
CAACTTAACAGTTATGCCGAACTTAATGGGACATGAAGAT
CAAAATGAGGCAGCCATAAAGCTGCATGAGTTTGCTCCGC
TGATTGAGTTCGGCTGTCACAGCCATCTGAAGTTTTTCTT
GTGCTCACTCTACGCACCCATGTGCACAGAACAGGTATCC
ACACCTATCCCAGCATGCCGAGTGATGTGCGAGCAGGCAA
GGCAGAAGTGTTCTCCCATCATGGAGCAGTTCAACTTTCA
CTGGCCTGAGTCGCTGGACTGTTCCAGACTGCCAAATAAA
AACGACCCCAATTACCTCTGTATGGAAGCTCCCAACAATG
GCACAGATGAGCCCCCAAAGGGCTCCCACACTCAGTCGCC
AGACTCCCGACCCCCTCGGCCAGGTAACAGCCAAGAACTG
CCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACC
CTGGAAAGTTTCATTATGTGCAAAAGAGTGAGTCCTGTGC
CCCCAAGTGTTACTCCAACGTAGATGTGTACTGGAGCCAG
GGCGACAAACGCTTCTCCATGGTGTGGATTGCTATCTGGT
CCATACTGTGCTTCATCTCTAGTGCCTTTACTGTCCTCAC
CTTTCTCATTGATCCCCAGCGCTTTAAGTACCCTGAGCGG
CCCATCATCTTCCTTTCTATGTCCTACTGTGTCTACTCTG
TGGGCTTTCTTGTAAGACTTTTTGTGGGGGTGGAAAATGT
GGCCTGTGATCGTGACACTGGAGTTCAGTACATCATCCAG
GAAGGCCTGGAAAGCACTGGCTGCACCATAGTCTTCCTCA
TTCTTTACTACTTCGGGATGGCCAGTTCCCTGTGGTGGGT
CATTCTTACTCTCACATGGTTCCTCGCAGCTGGAAAAAAA
TGGGGTCACGAGGCCATCGAAGCCAACAGCAGCTACTTCC
ATCTGGCGGCATGGGCTATACCAGCCATCAAGACCATCAT
GATCCTGGTTATGAGGAAGGTAGCAGGAGACGAGCTCACT
GGAGTCTGCTATGTAGGCAGCATGGATGTCAAAGCCTTGA
CTGGTTTTGTTCTTATTCCTCTCTCTTGCTACCTCATCAT
CGGCACTTCATTTTTACTCTCAGGGTTTGTTGCACTCTTT
CACATCCGTAAGGTCATGAAGACCGAGGGAGAGAATACGG
ATAAGCTGGAGAAGCTGATGGTTAGGATCGGCGTGTTCTC
TGTGCTCTACACAGTCCCCGCCACTTGCGTCATCGCCTGC
TATTTTTACGAGCGTCTCAACATGGATTATTGGAAGATTC
TAGCAGGAGAACAGAAGTGCGCCGATGACGGTAAAAGTGG
GGAAGAGTGCGTGATGAAGAGCTCCATCCCTGCCGTAGAG
ATTTTCATGGTAAAGATTTTCATGTTGTTGGTGGTGGGCA
TCACCAGCGGCATGTGGATCTGGACCTCTAAAACACTGCA
GTCGTGGCAGAATGTTTTCAGTCGCAAACTTAAGAAGAAG
ACAAGGAGGAAGGCTGCATGTGTTTTCACAGGAAGTGGAC
CTTACCTCAAGCCTCATCCTGCACTAAAAGGACACAAAAC
TAAGTACGAACCAGCAGGTCCTCCTGCAACTTGTGTATGA
GCTGGGTCTCTACGCACACGCAAACAGCCAGAAATGAAAA
CTCTGAACTTTAACAAACTGCTTTATAAAAGGACAAGCCA
GCAAAGAACTCCACAATTCTCGTATTTATTATATGCAAAC
TTCAGGTGCAGCATCCCCAACAAGTTTGTTCAGTTCCTAG
TGTTTGTGCTGCATCTGAAACTTTGCAGACTGGAATTACA
AAACAAAGTAAAAGGGAGTGAGTCCCTTGTGCTGTCATTG
GGATGCCTATATCTTGTCATGTGCAATAGTTTGTTTCCCT
TAGTGACAGAGAAAAAGGGACTCTGTAGAGCTGTGATTAA
AGACAATGAAAGGACTCGACAAACAATGGGTGTGAATGGC
TGGAGGAAAAGCAGCTCCTCTGTGGTGTAGTCGTGTGGCT
TTTCTATGGAAATGAAGGCTGTGTCATACACAACTGCATT
GACATTGGAGTGCAGCTGCTCAATAAGGCTTTGGCAGAGA
ATGAACTGCCTATTTTTAGGCCTTTAAATGGAACAAAGTG
AATCTTTAAGCACTAAATATTGCCAACACAATGAGAAAAA
CCTTGTTATTTGAGTGGTTTTGTACAGTGAGATCATGTCC
CTGGTTTGTTTTGTTACACCAAGCTCTTTTTAATGTCCAT
ACATTTGTGTATATTTCTAAAGGTCCATATTTTATAAGAA
TAAATAAAACAATTTAGTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations