header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2281
Transcript Name: fzd10-201
Previous Name: ottdart00000061751

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061751 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061751|OTTDARG00000042741|ZDB-GENE-990415-220 fzd10|OTTDARP00000048296 fzd10-001 LG_ CR450819.7 Danio rerio protein_coding KNOWN, 2982 bp
GGCGGAGGAGCTCAGACACAGACAGCGCGCGAGGCAGAGA
GCTGCTCTTCAGGGAGAAACGGACACGAGCTAAAGTGAAT
ACTCACACGTTTACGGAGAGGATTCGTTCATTCATTTAAC
ATGACTGCGATGTAACGACACCGTGCCTTCCGTTTGGTCA
GTTTGGATACACTTTGCGGAGGATGTGTGTGTGTGTTTAA
AGTAGCGCGGGAGCTATTTGAAAAGTAAGTGTACTTTTGT
GAAGAAACAGACCGTCAGCGATGTTTCACAGAACTGGAGA
GATTTAAAGTACGGGTATATCATCTGTGGACTGGGAATTG
AACATTAACAGCGCGAAACCTCTCAAAATAGTGAAAGTTT
TTTTCATTTTTTTTCATCTGTTTGAAGATTTTTACGCACT
AAATTCTCCTGTTACTCTTTTTTGGGATATAATAACTTTT
TAAATTAAAACTAAAACAACAATGAAGAAACTTTTCTAGT
GAAACAAAGCTTTTCGGAGAACAATATCTGCTATACATGA
GTTAATATTGAAAGACAATGTTTGCTGCCGGTGTCGGACT
CAGCCTTGGGCTGCTGTGCTTTGCTGGGTTTTGTTCTGCG
ATCAGTTCCATCGACCCGGACCGGCCAGGTGAAGGAAGAT
GCCAGGAGATTGCCATTCCTCTCTGTAAGGACATTGGCTA
CAACTTAACAGTTATGCCGAACTTAATGGGACATGAAGAT
CAAAATGAGGCAGCCATAAAGCTGCATGAGTTTGCTCCGC
TGATTGAGTTCGGCTGTCACAGCCATCTGAAGTTTTTCTT
GTGCTCACTCTACGCACCCATGTGCACAGAACAGGTATCC
ACACCTATCCCAGCATGCCGAGTGATGTGCGAGCAGGCAA
GGCAGAAGTGTTCTCCCATCATGGAGCAGTTCAACTTTCA
CTGGCCTGAGTCGCTGGACTGTTCCAGACTGCCAAATAAA
AACGACCCCAATTACCTCTGTATGGAAGCTCCCAACAATG
GCACAGATGAGCCCCCAAAGGGCTCCCACACTCAGTCGCC
AGACTCCCGACCCCCTCGGCCAGGTAACAGCCAAGAACTG
CCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACC
CTGGAAAGTTTCATTATGTGCAAAAGAGTGAGTCCTGTGC
CCCCAAGTGTTACTCCAACGTAGATGTGTACTGGAGCCAG
GGCGACAAACGCTTCTCCATGGTGTGGATTGCTATCTGGT
CCATACTGTGCTTCATCTCTAGTGCCTTTACTGTCCTCAC
CTTTCTCATTGATCCCCAGCGCTTTAAGTACCCTGAGCGG
CCCATCATCTTCCTTTCTATGTCCTACTGTGTCTACTCTG
TGGGCTTTCTTGTAAGACTTTTTGTGGGGGTGGAAAATGT
GGCCTGTGATCGTGACACTGGAGTTCAGTACATCATCCAG
GAAGGCCTGGAAAGCACTGGCTGCACCATAGTCTTCCTCA
TTCTTTACTACTTCGGGATGGCCAGTTCCCTGTGGTGGGT
CATTCTTACTCTCACATGGTTCCTCGCAGCTGGAAAAAAA
TGGGGTCACGAGGCCATCGAAGCCAACAGCAGCTACTTCC
ATCTGGCGGCATGGGCTATACCAGCCATCAAGACCATCAT
GATCCTGGTTATGAGGAAGGTAGCAGGAGACGAGCTCACT
GGAGTCTGCTATGTAGGCAGCATGGATGTCAAAGCCTTGA
CTGGTTTTGTTCTTATTCCTCTCTCTTGCTACCTCATCAT
CGGCACTTCATTTTTACTCTCAGGGTTTGTTGCACTCTTT
CACATCCGTAAGGTCATGAAGACCGAGGGAGAGAATACGG
ATAAGCTGGAGAAGCTGATGGTTAGGATCGGCGTGTTCTC
TGTGCTCTACACAGTCCCCGCCACTTGCGTCATCGCCTGC
TATTTTTACGAGCGTCTCAACATGGATTATTGGAAGATTC
TAGCAGGAGAACAGAAGTGCGCCGATGACGGTAAAAGTGG
GGAAGAGTGCGTGATGAAGAGCTCCATCCCTGCCGTAGAG
ATTTTCATGGTAAAGATTTTCATGTTGTTGGTGGTGGGCA
TCACCAGCGGCATGTGGATCTGGACCTCTAAAACACTGCA
GTCGTGGCAGAATGTTTTCAGTCGCAAACTTAAGAAGAAG
ACAAGGAGGAAGGCTGCATGTGTTTTCACAGGAAGTGGAC
CTTACCTCAAGCCTCATCCTGCACTAAAAGGACACAAAAC
TAAGTACGAACCAGCAGGTCCTCCTGCAACTTGTGTATGA
GCTGGGTCTCTACGCACACGCAAACAGCCAGAAATGAAAA
CTCTGAACTTTAACAAACTGCTTTATAAAAGGACAAGCCA
GCAAAGAACTCCACAATTCTCGTATTTATTATATGCAAAC
TTCAGGTGCAGCATCCCCAACAAGTTTGTTCAGTTCCTAG
TGTTTGTGCTGCATCTGAAACTTTGCAGACTGGAATTACA
AAACAAAGTAAAAGGGAGTGAGTCCCTTGTGCTGTCATTG
GGATGCCTATATCTTGTCATGTGCAATAGTTTGTTTCCCT
TAGTGACAGAGAAAAAGGGACTCTGTAGAGCTGTGATTAA
AGACAATGAAAGGACTCGACAAACAATGGGTGTGAATGGC
TGGAGGAAAAGCAGCTCCTCTGTGGTGTAGTCGTGTGGCT
TTTCTATGGAAATGAAGGCTGTGTCATACACAACTGCATT
GACATTGGAGTGCAGCTGCTCAATAAGGCTTTGGCAGAGA
ATGAACTGCCTATTTTTAGGCCTTTAAATGGAACAAAGTG
AATCTTTAAGCACTAAATATTGCCAACACAATGAGAAAAA
CCTTGTTATTTGAGTGGTTTTGTACAGTGAGATCATGTCC
CTGGTTTGTTTTGTTACACCAAGCTCTTTTTAATGTCCAT
ACATTTGTGTATATTTCTAAAGGTCCATATTTTATAAGAA
TAAATAAAACAATTTAGTTTTA

fzd10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fzd10-201 2982
ottdart00000003872 (1) 2912
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fzd10-201 Contained in:
[BAC] DKEY-245G2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000061751 (1),  Ensembl_Trans:ENSDART00000098520 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076546 (1) 3005 bp
CITATIONS (2)