header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22686
Transcript Name: ottdart00000003872
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000003872 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000003872|OTTDARG00000003685|ZDB-GENE-990415-220 fzd10|OTTDARP00000003527 fzd10-001 LG_ AL591180.4 Danio rerio protein_coding KNOWN, 2912 bp
CTAAAGTGAATACTCACACGTTTACGGAGAGGATTCGTTC
ATTCATTTAACATGACTGCGATGTAACGACACCGTGCCTT
CAGTTTGGTCAGTTTGGATACACTTTGCGGAGGATGTGTG
TGTGTTTAAAGTAGCGCGGGAGCTATTTGAAAAGTAAGTG
TACTTTTGTGAAGAAACAGACCGTCAGCGATGTTTCACAG
AACTGGAGAGATTTAAAGTACGGGTATATCATCTGTGGAC
TGGGAATTGAACATTAACAGCGCGAAAGCTCTCAAAATAG
TGAAAGTTTTTTTCATTTTTTTTTCATCTGTTTGAAGATT
TTTACGCACTAAATTCTCCTGTTACTCTTTTTTGGGATAT
AATAACTTTTTAAATTAAAACTAAAACAACAATGAAGAAA
CTTTTCTAGTGAAACAAAGCTTTTCGGAGAACAATATCTG
CTATACATGAGTTAATATTGAAAGACAATGTTTGCTGCCG
GTGTCGGAATCAGCCTTGGGCTGCTGTGCTTTGCTGGGTT
TTGTTCTGCGATCAGTTCCATCGACCCGGACCGGCCAGGT
GAAGGAAGATGCCAGGAGATTGCCATTCCTCTCTGTAAGG
ACATTGGCTACAACTTAACAGTTATGCCGAACTTAATGGG
ACATGAAGATCAAAATGAGGCAGCCATAAAGCTGCATGAG
TTTGCTCCGCTGATTGAGTTCGGCTGTCACAGCCATCTGA
AGTTTTTCTTGTGCTCACTCTACGCACCCATGTGCACAGA
ACAGGTATCCACACCTATCCCAGCATGCCGAGTGATGTGC
GAGCAGGCAAGGCAGAAGTGTTCTCCCATCATGGAGCAGT
TCAACTTTCACTGGCCTGAGTCGCTGGACTGTTCCAGACT
GCCAAATAAAAACGACCCCAATTACCTCTGTATGGAAGCT
CCCAACAATGGCACAGATGAGCCCCCAAAGGGCTCCCACA
CTCAGTCGCCAGACTCCCGACCCCCTCGGCCAGGTAACAG
CCAAGAACTGCCTATTAAAGAGAGGGTCGGTAAGACCACA
TGCAGCAACCCTGGAAAGTTTCATTATGTGCAGAAGAGTG
AGTCCTGTGCCCCCAAGTGTTACTCCAACGTAGATGTGTA
CTGGAGCCAGGGCGACAAACGCTTCTCCATGGTGTGGATT
GCTATCTGGTCCATACTGTGCTTCATCTCTAGTGCCTTTA
CTGTCCTCACCTTTCTCATTGATCCCCAGCGCTTTAAGTA
CCCTGAGCGGCCCATCATCTTCCTTTCTATGTCCTACTGT
GTCTACTCTGTGGGCTTTCTTGTAAGACTTTTTGTGGGGG
TGGAAAATGTGGCCTGTGATCGTGACACTGGAGTTCAGTA
CATCATCCAGGAAGGCCTGGAAAGCACTGGCTGCACCATA
GTCTTCCTCATTCTTTACTACTTCGGGATGGCCAGTTCCC
TGTGGTGGGTCATTCTTACTCTCACATGGTTCCTCGCAGC
TGGAAAAAAATGGGGTCACGAGGCCATCGAAGCCAACAGC
AGCTACTTCCATCTGGCGGCATGGGCTATACCAGCCATCA
AGACCATCATGATCCTGGTTATGAGGAAGGTAGCAGGAGA
CGAGCTCACTGGAGTCTGCTATGTAGGCAGCATGGATGTC
AAAGCCTTGACTGGTTTTGTTCTTATTCCTCTCTCTTGCT
ACCTCATCATCGGCACTTCATTTTTACTCTCAGGGTTTGT
TGCACTCTTTCACATCCGTAAGGTCATGAAGACCGAGGGA
GAGAATACGGATAAGCTGGAGAAGCTGATGGTTAGGATCG
GCGTGTTCTCTGTGCTCTACACAGTCCCCGCCACTTGCGT
CATCGCCTGCTATTTTTACGAGCGTCTCAACATGGATTAT
TGGAAGATTCTAGCAGGAGAACAGAAGTGCGCCGATGACG
GTAAAAGTGGGGAAGAGTGCGTGATGAAGAGCTCCATCCC
TGCCGTAGAGATTTTCATGGTAAAGATTTTCATGTTGTTG
GTGGTGGGCATCACCAGCGGCATGTGGATCTGGACCTCTA
AAACACTGCAGTCGTGGCAGAATGTTTTCAGTCGCAAACT
TAAGAAGAAGACAAGGAGGAAGGCTGCATGTGTTTTCACT
GGAAGTGGACCTTACCTCAAGCCTCATCCTGCACTAAAAG
GACACAAAACTAAGTACGAACCAGCAGGTCCTCCTGCAAC
TTGTGTATGAGCTGGGTCTCTACGCACACGCAAACAGCCA
GAAATGAAAACTCTGAACTTTAACAAACTGCTTTATAAAA
GGACAAGCCAGCAAAGAACTCCACAATTCTCGTATTTATT
ATATGCAAACTTCAGGTGCAGCATCCCCAACAAGTTTGTT
CAGTTCCTAGTGTTTGTGCTGCATCTGAAACTTTGCAGAC
TGGAATTACAAAACAAAGTAAAAGGGAGTGAGTCCCTTGT
GCTGTCATTGGGATGCCTATATCTTGTCATGTGCAATAGT
TTGTTTCCCTTAGTGACAGAGAAAAAGGGACTCTGTAGAG
CTGTGATTAAAGACAATGAAAGGACTCGACAAACAATGGG
TGTGAATGGCTGGAGGAAAAGCAGCTCCTCTGTGGTGTAG
TCATGTGGCTTTTCTATGGAAATGAAGGCTGTGTCATACA
CAACTGCATTGACATTGGAGTGCAGCTGCTCAGTAAGGCT
TTGGCAGAGAATGAACTGCCTATTTTTAGGCCTTTAAATG
GAACAAAGTGAATCTTTAAGCACTAAATATTGCCAACACA
ATGAGAAAAACCTTGTTATTTGAGTGGTTTTGTACAGTGA
GATCATGTCCCTGGTTTGTTTTGTTACACCAAGCTCTTTT
TAATGTCCATACATTTGTGTATATTTCTAAAGGTCCATAT
TTTATAAGAATAAATAAAACAATTTAGTTTTA

fzd10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fzd10-201 (1)    Ensembl 2982
ottdart00000003872 2912
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000003872 Contained in:

Genome Resources: Vega_Trans:OTTDART00000003872 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AF039411 (1) 2926 bp
GenBank:AW128715 (1) 586 bp
GenBank:AW777639 (1) 501 bp
GenBank:AW778381 (1) 178 bp
CITATIONS (1)