Transcript

cadm1a-201

ID
ZDB-TSCRIPT-091110-961
Name
cadm1a-201
Previous Names
  • cadm1a-002
  • dkey-17e16.8-001
  • ottdart00000043381
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043381 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043381|OTTDARG00000031199|ZDB-GENE-080505-2 cadm1a|OTTDARP00000034394 cadm1a-002 LG_none CR383675.13,BX890610.8,CR394571.7,CR759955.13 Danio rerio protein_coding KNOWN, 1225 bp
AATGAAGCAGGTGTCCAACATGGCGAACACGAGCAACGGA
TCTCTCGCTACTCTCCTCATTTTAATCACCATTTCGGCAG
CTATCCACACAGGAGCTGCTCAGTACCCAGTCCAAAGTCA
GAATCTCATATCGGACAACGTCTCAGTAGTGGAAGGAGAG
ACAGCCACCATAAGCTGTCGAGTCAAAAACAATGACGACT
CCGTCATCCAGCTCCTTAACCCCAACAGACAGACCATCTA
CTTCAAAGACGTCAGACCCCTGAAAGATGCTCGATTCCAG
CTGGTCAATTTCTCAGACAACGAGCTTCGTGTATCGTTAT
CCAACGTGTCTCTGTCAGACGAGGGCAGATACGTGTGCCA
GCTCTACACAGACCCTCCACAGGAAGCCTACGCCGACATC
ACTGTGCTAATCCCACCAGGAAACCCAATCATAGAGTCCC
GCGAGGACATCGTCAGCGAGGGCAACGAGACAGAGATAAC
CTGCACCTCCATGGGCAGCAAACCCGCCGCAACCATCAGA
TGGATGAAAGGAGACAAAGAGCTACAGGGCAAGTCTAAGG
TGGAGCTCACATATGACAAGATGTTCACTGTGACGAGCTG
GCTGAGGTTAACAGTCACGAGAGAAGACGACGGTGTTCCA
GTGGTCTGCATTGTTGACCATCCAGCAGTCAAGGACTTTC
AGGCACAGAAGTACCTCGAAGTGCAATATAAACCTGAGGT
GCAGATCGTGGTGGATTTTCCATCGGGCCCCATTAGAGAA
GGAGAAAACCTGGAACTGACATGCCTGGCTAAAGGCAAAC
CTGAGCCTCAGCAGGTGAACTGGGTAAGGGTGGACGATGA
TGTGCCATCTCACGCTGTTATCACTGGTTCAGATCTCTTC
ATCGAGAATCTCAACAAGTCCTACAATGGCACTTACCGAT
GCGTGGCGTCCAACCCTTTGGGTGAAGCGTATGATGACTA
CATCCTCTTTGTACGCGATTCCCAAGCAGGAGCAGAAACA
CAGAGATCAATGGACCATGCCCTTATCGGAGGTGTGGTGG
CCGTCGTGGTCTTCGCCATGTTGTGTCTTCTCATCGTTTT
GGGCCGATACTTTGCAAGACACAAAGGCACCTACTTCACA
CACGAAGCCAAGGGGGCAGACGACGCGGCGGATGCCGACA
CGGCCATCATCAACGCCGAAGGGGGCCACAACAACTCGGA
CGAGAAGAAAGAATACTATATCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations