Transcript

cadm1a-204

ID
ZDB-TSCRIPT-091110-230
Name
cadm1a-204
Previous Names
  • cadm1a-001
  • ottdart00000043380
  • rp71-11b17.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043380 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043380|OTTDARG00000031199|ZDB-GENE-080505-2 cadm1a|OTTDARP00000034393 cadm1a-001 LG_none CR383675.13,BX890610.8,CR394571.7,CR759955.13 Danio rerio protein_coding KNOWN, 1342 bp
AATGAAGCAGGTGTCCAACATGGCGAACACGAGCAACGGA
TCTCTCGCTACTCTCCTCATTTTAATCACCATTTCGGCAG
CTATCCACACAGGAGCTGCTCAGTACCCAGTCCAAAGTCA
GAATCTCATATCGGACAACGTCTCAGTAGTGGAAGGAGAG
ACAGCCACCATAAGCTGTCGAGTCAAAAACAATGACGACT
CCGTCATCCAGCTCCTTAACCCCAACAGACAGACCATCTA
CTTCAAAGACGTCAGACCCCTGAAAGATGCTCGATTCCAG
CTGGTCAATTTCTCAGACAACGAGCTTCGTGTATCGTTAT
CCAACGTGTCTCTGTCAGACGAGGGCAGATACGTGTGCCA
GCTCTACACAGACCCTCCACAGGAAGCCTACGCCGACATC
ACTGTGCTAATCCCACCAGGAAACCCAATCATAGAGTCCC
GCGAGGACATCGTCAGCGAGGGCAACGAGACAGAGATAAC
CTGCACCTCCATGGGCAGCAAACCCGCCGCAACCATCAGA
TGGATGAAAGGAGACAAAGAGCTACAGGGCAAGTCTAAGG
TGGAGCTCACATATGACAAGATGTTCACTGTGACGAGCTG
GCTGAGGTTAACAGTCACGAGAGAAGACGACGGTGTTCCA
GTGGTCTGCATTGTTGACCATCCAGCAGTCAAGGACTTTC
AGGCACAGAAGTACCTCGAAGTGCAATATAAACCTGAGGT
GCAGATCGTGGTGGATTTTCCATCGGGCCCCATTAGAGAA
GGAGAAAACCTGGAACTGACATGCCTGGCTAAAGGCAAAC
CTGAGCCTCAGCAGGTGAACTGGGTAAGGGTGGACGATGA
TGTGCCATCTCACGCTGTTATCACTGGTTCAGATCTCTTC
ATCGAGAATCTCAACAAGTCCTACAATGGCACTTACCGAT
GCGTGGCGTCCAACCCTTTGGGTGAAGCGTATGATGACTA
CATCCTCTTTGTACGCGATGCCCTTACCACAACCCCTAAA
CCCACAACCACCACCACCACCACCATCTCCGCCACAACCT
CCCCTCCAGACGTCATACAAGACGCTGCGCCCAGCACTGA
AGCCGCAGCTCACGATTCCCAAGCAGGAGCAGAAACACAG
AGATCAATGGACCATGCCCTTATCGGAGGTGTGGTGGCCG
TCGTGGTCTTCGCCATGTTGTGTCTTCTCATCGTTTTGGG
CCGATACTTTGCAAGACACAAAGGCACCTACTTCACACAC
GAAGCCAAGGGGGCAGACGACGCGGCGGATGCCGACACGG
CCATCATCAACGCCGAAGGGGGCCACAACAACTCGGACGA
GAAGAAAGAATACTATATCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations