Transcript

grik1a-202

ID
ZDB-TSCRIPT-091110-918
Name
grik1a-202
Previous Names
  • grik1a-003
  • ch211-155e13.2-002
  • ottdart00000043243
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043243 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043243|OTTDARG00000031100|ZDB-GENE-030131-6502 grik1a|OTTDARP00000034284 grik1a-003 LG_none CT573197.7,AL954816.21,AL837524.9 Danio rerio protein_coding KNOWN, 747 bp
ATTAAGGATATTGGGACTCTACTGAACTTGCGACAACCAC
GTAATCTTTTCACAACTTAGGTTCCTGCTGGAAAGACTTT
CAAAAAAGAGGCATCTTTGAGACACGGGAAAATGAACCTG
TCAGTATGGATGAACTCGCCTTTAAATTTGCTGTTACAAG
TATCAATCGAAACAGAACTTTGATGCCAAACACCACGTTG
ACCTACGACATCCAGAGAGTAAACCTCTTTGACAGCTTTG
AAGCCTCCAGAAGGGTGTGTGACCAGTTGGCCCTGGGGGT
TGCGGCAGTCTTCGGCCCTTCTCACAGCTCCTCGGTCAGT
GCCGTTCAATCCATTTGCAATGCCCTAGAGGTGCCGCACA
TCCAGACACGCTGGAAACACCCGTCTGTGGACAATAAAGA
CAATTTTTACATTAACCTCTACCCCGAGTACACCTCCATA
AGCAGGGCTATCCTGGACATTGTCATTTTCTACAAATGGA
AGTGCGTTACTGTGGTTTATGAGGACAGCACAGGTTTAAT
GCGTATGCAGGAACTGATCAAAGCTCCATCTAAAAACAAC
TTGAAGATCCGTATCCGCCAGCTGCCGTCGGGAGGAGGCG
ACAGTCGCCCCCTTCTGAAGGAGATGAAGAAAGAGAAGGA
GTTTTACGTCATCTTCGACTGCTCCTACCAAGTAGCCGCC
GAGCTTCTCAAACAGCTGATGTCAATGGGCATGATGACGG
AGTACTATCATTTCTTCTTCACTACAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations