Transcript

grik1a-004

ID
ZDB-TSCRIPT-091110-1644
Name
grik1a-004
Previous Names
  • dkey-3h23.2-001
  • ottdart00000043244
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043244 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043244|OTTDARG00000031100|ZDB-GENE-030131-6502 grik1a|no_translation grik1a-004 LG_none CT573197.7,AL954816.21,AL837524.9 Danio rerio protein_coding KNOWN, 756 bp
TCCAGGAACAGGATTGAGCACCCCTGCTCTAAACTATTCT
GTGTGTTGTCTTGCCACATAAAACACCTGCTGTTCTCTTT
AGGCTCACCATACCGGGACAAGGTGACCATCGCCATCCTG
CAGCTCCAGGAAGAGGGAAAATTGCACATGATGAAGGAGA
AATGGTGGCGAGGAAACGGCTGTCCAGAAGAGGACAGCAA
AGAGGCCAGTGCCCTGGGTGTGGAGAACATCGGGGGCATC
TTTATCGTCCTGGCAGCCGGACTCGTGCTGTCTGTGTTCG
TGGCCATCGGAGAGTTCATCTACAAATCACACAAAAACAG
CGATATTGAAGAGTGCTGTGATGGAAGACCTGGGCATATC
CCTCAGGTGCCACAAGGCGTTGAGGAAGAGAGGCAGACAC
AGAGGAAGAGCAGGCCTGTCTGGAGTCTTATGTAACCCCA
AACGCATCCCGAGGAAAGAGACAATGGCCTAGATCCTCCT
CCAACCGCCACGCAACCTGCGGGTGAAATCAGTCTCTGAG
GCTGTGTGTTTTTCATTCAATCTCTGTGCTTTTTATTCAT
GAATTTGCAGGCTTTTATATGAGTGGATTGTGGTAATTTC
ACATAGACCTTGGTAATATCTTGAGCCGATGGAACTGGAG
ACGAAAGGAATAATTTATTTTGAGATATTAATTAACGTAC
GAGCACATGGCGTAATTTGGTAGCATTTTATTGTGCTGTC
CTTGATTTCATAAATAAAAGCATACATATTTTACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations