ZFIN ID: ZDB-TSCRIPT-091110-800
Transcript Name: ash2l-004
Previous Names: ch73-232h9.5-001, dkey-171l20.2-004, ottdart00000042818

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042818 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042818|OTTDARG00000030810|ZDB-GENE-030131-494 ash2l|no_translation DKEY-171L20.2-004 LG_ CT027796.13 Danio rerio protein_coding KNOWN, 901 bp
CCTTCAACAAAGATGGCTATCGCTACATCCTAGCAGAGCC
GGATCCTCATGCTCCCGACCCGGAAAAACTGGAGCTGGAC
TGCTGGGCTGGAAAGCCCATTCCTGGAGACCTGTACCGGG
CATGTCTGTACGAGAGAGTCCTGCTAGCATTGCATGACAG
AGCTCCGCAGCTGAAGATTTCTGATGACCGGCTGACGGTG
ACCGGAGAGAAAGGCTACTCGATGGTGCGAGCGTCTCACG
GGGTCAGAAAAGGCTCGTGGTTTTTTGAGGTGACTGTGGA
TGAGATGCCTCAGGACGCTGCAGCTCGACTGGGCTGGTCG
CAGCCTTTAGGAAATCTGCAGGCTCCTTTGGGTTATGATA
AGTTCAGCTACTCGTGGCGCAGTAAGAAAGGCACACGCTT
CCATCAGTCCATTGGAAAGCATTACTCTGATGGCTACGGT
CTGGGAGATATCTTGGGCTTCTTCATCGAGCTTCCAGACG
AGACTGAAACCGCCAAGGCCCTGCCAGACACATACAAGGA
CAAAGTATTATTTTTGATTCAAATTAGTTGCATTCATTTA
TGTCCTAAAATCATGTAATGTTCAGGGTTCCCACTGCTTA
TGGACTTTCTGGAGTATAATGGAGTTTTAAAAGGTCTATT
TCATTCATTTAAAGTCAGGGTTTTTTTATTGATCTTTTGT
CTAAGTCATGGATTTTTGTTTATTGCTTAATTTTAGTTTC
CATTTAACAATATATGTATACTATTTTTGTAACCTTTTTT
CATTGTTTCACACCTATTGTTGTTATAGCTATTTTCAACG
TTATTCTATTCCTATCTTGCTTATTATTGTATGTTAAGTT
AAGGATAGAGTACATCCAGGTGGTTGTTATCACAGAATAA
AGCCCAGACAGGATTATCGGC

ash2l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ash2l-004 901
mRNA ash2l-201 (1) 2056
ash2l-202 (1) 1401
ash2l-203 (1) 831
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ash2l-004 Contained in:
OTHER ash2l-004 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042818 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH458782 (1) 905bp
    CITATIONS (1)