ZFIN ID: ZDB-TSCRIPT-091110-1524
Transcript Name: ash2l-002
Previous Names: ch211-161n19.3-001, dkey-171l20.2-002, ottdart00000042816

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042816 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042816|OTTDARG00000030810|ZDB-GENE-030131-494 ash2l|OTTDARP00000033992 DKEY-171L20.2-002 LG_ CT027796.13 Danio rerio protein_coding KNOWN, 831 bp
CAGAGGCGCGATCTGTGACTGAGAGAGACACCGCGGACGG
AGATGCCTCTTTTGGAGATCTGACCACAAACATGGAGACC
GAGTCGTCCAGTGGAAAGGAGACTATGGATACAGCCGGGG
ACAGTTCTGAAGCAGCGGACGCTCAGACGGGCTCTGGAGA
CGATGAGAACGGCCGTCAGCTGGGTGAAGTGGAGCTGCAG
TGTGCGCTGTGCATGAAGTGGTTCACCGCAGACACTTTCA
GCATCGACACGGCAACTTGCCTGCCATTCATGACCAATTA
TGTGTTTCACTGCAACGTGTGCCACCACAGTGGAAACACT
TACTTTCTGAGGAAACAAGCCAATCTGAAGGAAATGTGTC
TCACTGCTTTGGCAAATCTGACATGGCGGTCCAGAACTCA
AGAGGAGCATCCTAAAACTATGTTCTCTAAGGATAAGGAC
ATCATACCTTTCATTGACAAATATTGGGAGTGTATGACGA
CCCGCCAGAGACCCGGCAAACTAACATGGCCAAATAACAT
CGTCAAAACCATGAGCAAAGAGCGCGATGTTTTCCTCGTG
AAAGAACATCCTGATCCTGGCAGCAAAGACCCTGAAGAGG
ACTATCCTAAATTTGGTTTGCTCGATCAGGATCTGGGCAA
CATCGGACCGTCGTATGACAACCAGAAGCAGATGACCACA
GTCACGGGTGCTGGAGGATTGAACGCTGTGCGTTGTATTC
CAGGTGGATCAACCTTTTCAGGTGGGCTTCCTTCAGCTGC
TACAGGAAAAGGCAGAGGAGCCAAACGCAAACAGCAGCAG
CAACAGGATGGTGCCGCCACTGGAGCAGCCA

ash2l TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ash2l-001 (1) 2056
ash2l-002 831
ash2l-003 (1) 1401
ncRNA ash2l-004 (1) 901
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ash2l-002 Contained in:
OTHER ash2l-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042816 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)