ZFIN ID: ZDB-TSCRIPT-091110-1517
Transcript Name: ash2l-201
Previous Names: ash2l-001, dkey-171l20.2-001, dkey-24n17.5-001, ottdart00000042797

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042797 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042797|OTTDARG00000030810|ZDB-GENE-030131-494 ash2l|OTTDARP00000033976 DKEY-171L20.2-001 LG_ CT027796.13 Danio rerio protein_coding KNOWN, 2056 bp
GTTATTATAGAGTATTCCGGCAGGTGTCAATGTGCGCTGC
GGGAATCTCGCCGTACTCCAGCGAAGAAGCTCCGAGTCAT
CGCGAGATTTGCGTCTTTAGCTGCTGCTATTTGAAAGATG
GCTGCAGAGGCGCGATCTGTGACTGAGAGAGACACCGCGG
ACGGAGATGCCTCTTTTGGAGATCTGACCACAAACATGGA
GACCGAGTCGTCCAGTGGAAAGGAGACTATGGATACAGCC
GGGGACAGTTCTGAAGCAGCGGACGCTCAGACGGGCTCTG
GAGACGATGAGAACGGCCGTCAGCTGGGTGAAGTGGAGCT
GCAGTGTGCGCTGTGCATGAAGTGGTTCACCGCAGACACT
TTCAGCATCGACACGGCAACTTGCCTGCCATTCATGACCA
ATTATGTGTTTCACTGCAACGTGTGCCACCACAGTGGAAA
CACTTACTTTCTGAGGAAACAAGCCAATCTGAAGGAAATG
TGTCTCACTGCTTTGGCAAATCTGACATGGCGGTCCAGAA
CTCAAGAGGAGCATCCTAAAACTATGTTCTCTAAGGATAA
GGACATCATACCTTTCATTGACAAATATTGGGAGTGTATG
ACGACCCGCCAGAGACCCGGCAAACTAACATGGCCAAATA
ACATCGTCAAAACCATGAGCAAAGAGCGCGATGTTTTCCT
CGTGAAAGAACATCCTGATCCTGGCAGCAAAGACCCTGAA
GAGGACTATCCTAAATTTGGTTTGCTCGATCAGGATCTGG
GCAACATCGGACCGTCGTATGACAACCAGAAGCAGATGAC
CACAGTCACGGGTGCTGGAGGATTGAACGGTGGATCAACC
TTTTCAGGTGGGCTTCCTTCAGCTGCTACAGGAAAAGGCA
GAGGAGCCAAACGCAAACAGCAGCAGCAACAGGATGGTGC
CGCCACTGGAGCAGCCAAGAGAACACGCAGTGACCCTCTG
TTCTCAGCTCAGCGTCTGCCGCCTCACGGTTATCCTCTTG
AACATCCCTTCAACAAAGATGGCTATCGCTACATCCTAGC
AGAGCCGGATCCTCATGCTCCCGACCCGGAAAAACTGGAG
CTGGACTGCTGGGCTGGAAAGCCCATTCCTGGAGACCTGT
ACCGGGCATGTCTGTACGAGAGAGTCCTGCTAGCATTGCA
TGACAGAGCTCCGCAGCTGAAGATTTCTGATGACCGGCTG
ACGGTGACCGGAGAGAAAGGCTACTCGATGGTGCGAGCGT
CTCACGGGGTCAGAAAAGGCTCGTGGTTTTTTGAGGTGAC
TGTGGATGAGATGCCTCAGGACGCTGCAGCTCGACTGGGC
TGGTCGCAGCCTTTAGGAAATCTGCAGGCTCCTTTGGGTT
ATGATAAGTTCAGCTACTCGTGGCGCAGTAAGAAAGGCAC
ACGCTTCCATCAGTCCATTGGAAAGCATTACTCTGATGGC
TACGGTCTGGGAGATATCTTGGGCTTCTTCATCGAGCTTC
CAGACGAGACTGAAACCGCCAAGGCCCTGCCAGACACATA
CAAGGACAAAGCACTGATCAAATTCAAAAGCTACTTATAC
TTTGAAGAGAAAGATTATGTGGACAAGGCTGAGAAGAACT
TGAAACCCACCAGTACCAGCAGAATGATATTTTTCAAAAA
CGGCGTGAATCAAGGTGTGGCTTATGAAGATCTGTTTGAG
GGCATGTACTACCCCGCTATATCCCTCTACAAGGGCTGCA
CGGTCTCTGTCAATTTTGGACCCCACTTCAAATACCCACC
AAAAGACATCAAGTTTCAGCCAATGAGCGATATGGGTTGG
GGTGCAGTCATCGAGCACACACTGGCTGATATGCTGTACC
ACGTGGAGACTGAAGTGGACGGCCGACGAAGCCCTCAATA
TGAAGGTTAATCACAAGCATCTGAAAACACTGACTGACAC
ACATCCACCAAATACAGACGCTTCCCTGCACCATTCTCAA
ACACACACACATAAAGCAGTTTGGCTATTATTTTGATTTG
CAGTGCTCTTCTTTCCGTGTGCTGCTTTGTTTTCCGATTA
AAAAAGTCAGCGGGTA

ash2l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ash2l-004 (1) 901
mRNA ash2l-201 2056
ash2l-202 (1) 1401
ash2l-203 (1) 831
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ash2l-201 Contained in:
OTHER ash2l-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042797 (1)
  • Ensembl_Trans:ENSDART00000085031 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153922 (1) 1955bp
    CITATIONS (2)