Transcript

rnpc3-202

ID
ZDB-TSCRIPT-091110-563
Name
rnpc3-202
Previous Names
  • rnpc3-003
  • rnpc3_1-003
  • ch211-266i10.3-001
  • ottdart00000044681
  • zfinnucl0000004596
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044681 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044681|OTTDARG00000032025|ZDB-GENE-060312-35 rnpc3|OTTDARP00000035352 rnpc3-003 LG_ CT961047.6 Danio rerio protein_coding KNOWN, 897 bp
CAGAATCAAAAGCTGCCATTCGCAGATGCAACTGAAGACA
CACCAGATATGGAGGTTTCTGCTCAGGAAACCACAGAAGG
TTTTGGAAAGATCTACCCAAGCGCTCAGGTCCCGAGACAG
GAGGAAGAGCAGGAGGAAGATGAAGACATCCCGTCTGAGT
TCATCTCCAGGAGAGAGCTAGAGAGAGGCAGACTCTCCAG
AGATGAGATAAAGAAATTGTCTGTTTTTAAAAAGTACGAA
CCCGGAGAACCAACCTGCAGGCTTTATGTTAAGAATGTTG
CAAAGCACGTTGAAGAAAAAGATCTGAAGTTCATATACGG
CCGGTATATCGACATCTCCTCAGAGGAAGAGAGAAACATG
TTTGATATCGTTTTGATGAAAGAGGGGAGGATGAAAGGTC
AGGCCTTCATCGGACTGCCCAGCGAAAGAAGCGCACAGAA
GGCCCTGAAGGAAACCAATGGATATGTGCTCAAGGACAAA
CCTCTGGTGGTGCAATTCGCACGATCTGCAAAGCCTAAAC
AGGAATCTGCTGACCCGAAGAAAGGAGGGAGAAAACACTG
AAGTGATGATGTTGATGTTGCTTCAAATTACCTCAATCAT
GAGCCGACAGGAGCTCCATCTTTACAGCATATCCTTTAAT
ATATCCTTCAAAAGAGTTATTTAATTTGAATACACACTAT
AAACTGGATTTTTCCAAATGTCAAGCAATATTTTTCTACT
TTACACACACACAAAATATGTTGAATATTAAAATGTTTAT
TTTCCCTCGGTTTTATTGCAGACTGCCCTGGTTGAGTCCT
CTCGGGCCGAAGTTCATCAGCTGATATGATTTTTTTGTTT
TAATATAAAGTTTAGTTTTGTCAATATGTCTTAAAATAAA
AGCAAATAATACCTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations