Transcript

rnpc3-201

ID
ZDB-TSCRIPT-091110-2002
Name
rnpc3-201
Previous Names
  • rnpc3-001
  • rnpc3_1-001
  • ch211-253b1.6-001
  • ottdart00000044657
  • zfinnucl0000004671
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044657 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044657|OTTDARG00000032025|ZDB-GENE-060312-35 rnpc3|OTTDARP00000035332 rnpc3-001 LG_ CT961047.6 Danio rerio protein_coding KNOWN, 1729 bp
AGACACGCCTACAAGCGTCGAAAACTGCGGAAAAGGGTGA
ATTTGAATCGGGATCATGGCGGAGACGGACGAGGCTGACG
TTCAAACAAAGAAAAGCAAAACCCTCATCATTCGACATCT
GCCCAGAGAGCTCAGCAGAGATGAGAAAGAGGATTTGCTC
AAGTACTTTGGGGCCTCATCTGTCAGAGTGCTGTCAGAAA
AGGGACCCCTAAAACATATGGCCTTCGCAACTTTCAGCAG
TGAGACCTCAGCTTCAAAGGCGCTAAACAGACTTCATCAA
CTCAGGATCCTCGGTCGCACACTAGTGGTGGAGTTTGCAA
AAGATCAAGACAGCGCCAGTATTTTGAAAGATCCACCTGT
TTCCGACAGAACTGCTGCTGCCGTAGCCGAAAAAGAAAAG
AAAGAAAAACAACAACCCAGTGTTCCTCTGATGGACACCA
GCATTGCTCCCAGTCTGGGGTTGAAATTTCAAACAAATCC
AACGCTGAAATATTTATATCCTCCTCCTTCAAGTGGAATT
TTGACAAACATCACACACACACTTCTGAGTGTGCCCAAGT
TCTACGTTCAAGTTCTTCACCTGATGAATAAGATGAACCT
GCCATCTCCGTTTAGGCCAGTGACAGCTCCTCCGCCAATG
TTTGAGATGCCTTCAGGCCCGTTGCCTCCGCCTTTCCCCC
CTGAAAACCCTCCTCTTCCTGAGCATGACGAGTCAGGCAG
CGAAGAAGAGTCCGAGTATGAAAGCGAGGATGAAGAGGAG
AGAGAGAGGATGATCAGACTGATGGGCCTTGTTAACCAGC
CATGCAAAAGACCGCTGAGAACAAAGACTTCTTCCAAGAG
AAAGAAACCCAAACTCAAAGACCTCCTGTTTATTCCCAAA
CCGGATTCCCACGGCCCATCAGGTCCAGTCCTGCAGCCGG
CGGATGTGTTTGAGCAACCTCATGCACTTGGACAGAAAAA
GATCGAGTTTCATATATCGTCTGAGGTGTCTGCTATCCTC
GAGGGGCCTGGACAGAATCAAAAGCTGCCATTCGCAGATG
CAACTGAAGACACACCAGATATGGAGGTTTCTGCTCAGGA
AACCACAGAAGGTTTTGGAAAGATCTACCCAAGCGCTCAG
GTCCCGAGACAGGAGGAAGAGCAGGAGGAAGATGAAGACA
TCCCGTCTGAGTTCATCTCCAGGAGAGAGCTAGAGAGAGG
CAGACTCTCCAGAGATGAGATAAAGAAATTGTCTGTTTTT
AAAAAGTACGAACCCGGAGAACCAACCTGCAGGCTTTATG
TTAAGAATGTTGCAAAGCACGTTGAAGAAAAAGATCTGAA
GTTCATATACGGCCGGTATATCGACATCTCCTCAGAGGAA
GAGAGAAACATGTTTGATATCGTTTTGATGAAAGAGGGGA
GGATGAAAGGTCAGGCCTTCATCGGACTGCCCAGCGAAAG
AAGCGCACAGAAGGCCCTGAAGGAAACCAATGGATATGTG
CTCAAGGACAAACCTCTGGTGGTGCAATTCGCACGATCTG
CAAAGCCTAAACAGGAATCTGCTGACCCGAAGAAAGGAGG
GAGAAAACACTGAAGTGACTGCCCTGGTTGAGTCCTCTCG
GGCCGAAGTTCATCAGCTGATATGATTTTTTTGTTTTAAT
ATAAAGTTTAGTTTTGTCAATATGTCTTAAAATAAAAGCA
AATAATACCTTCATCTGGTATCTTCATTAAAACTGCTGGC
CAATTTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations