Transcript

slc31a2-003

ID
ZDB-TSCRIPT-091110-336
Name
slc31a2-003
Previous Names
  • ch211-282j22.4-003
  • ch211-86k6.2-002
  • ottdart00000043773
  • si:ch211-282j22.4-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043773 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043773|OTTDARG00000031447|ZDB-GENE-030925-25 slc31a2|no_translation CH211-282J22.4-003 LG_none FP085417.10,BX649400.9 Danio rerio protein_coding NOVEL, 868 bp
AAGTTGCATGTTTGTCATAAGGGACGTTTCGTCTGTGTTA
AATTCCCTCGAACTCGTCTTTTGAGGACTTTTAAGAAGCG
AGTTCATCATGAATGTAAGTAGAACTCGATGTACTTTGAA
GGTTCCAGTAATGTCACGCTGTTGTTTAATTTCTGGAACG
TGCATGGACCTGCAGGTACAAACAAGACCCAACATGGTTA
TACATACACAAAATGACCAAACCAAACAGTCTTGCTTTAT
TTTTTTTCCTGCATGCTCAAAACCAAAAGTTGTTTAACTT
GTTTTCTTGTACACGTGATTTCATATTTAAGGTACAGTAA
GTAAAGGCATCTGTTATTTTCACATTATATTATTTGTATT
ATATTTGTATTATTTCATATAAGGTTCAATATTTTTATGT
TTTAATTTTTTATTTTAGTCTTTATTTCTTTAGTTTTGCA
ATCATTAATTATTCAACTAATTACTTACATTTATTGTTAA
AACTTTACAGGTTGTATTAGTTAATGCATTTACTGATATG
AACAGTCAATGAACAATATATTTTACAGTATTTATTCATC
TTTGGTGATGTTAGTTAAATGTAATAATGTTGTTCACTGT
TAGTGTGTTAACTGTGCATTAACTAGCAAGCAAGAATTAG
GATTTTAAAGCATTTTTTTTTATGTGAAACGATGATTAAT
AAATATGAGTATTGTTTCATGTTAGTAAATAAATAACTCT
TAACATAAACCTTAAAGTGTGACCAAATTCATTTAGTTAG
CTGCCAAAAACATGCTTCTATATTTATTTCATGAAATACA
TTTTATATTATTGGAACTGTATTAATTTTTAATCTCATGC
TGATTTCAATTTTGTAAGATTTATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations