Transcript

slc31a2-201

ID
ZDB-TSCRIPT-091110-1791
Name
slc31a2-201
Previous Names
  • dkey-11o15.6-001
  • slc31a2-002
  • ch211-282j22.4-002
  • ottdart00000043772
  • si:ch211-282j22.4-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043772 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043772|OTTDARG00000031447|ZDB-GENE-030925-25 slc31a2|OTTDARP00000039378 CH211-282J22.4-002 LG_none FP085417.10,BX649400.9 Danio rerio protein_coding NOVEL, 860 bp
GGCACGGCACTCGTTTTGTTTCGGGCAGAGCGCCTGTCAG
CTGTTGAGCTACTGTATAATGACAGATAAAATGTTTGCTG
ATGGGCAGTTGCTAATGAAAGTTGCATGTTTGTCATAAGG
GACGTTTCGTCTGTGTTAAATTCCCTCGAACTCGTCTTTT
GAGGACTTTTAAGAAGCGAGTTCATCATGAATGTAAGTAG
AACTCGATGTACTTTGAAGGTTCCAGTAATGTCACGCTGT
TGTTTAATTTCTGGAACGTGCATGGACCTGCAGGGATGGT
GCTGTCAGTGTTTGTAGTTCTGCTACTCACAGTGGTGTAC
GAGCTTCTGAAAGTGTGGAAAATCACCGTTGGGAAACAGA
AGTCGTCCCCCAACACAAGTCCCTCCACTGCAATGTCATT
CTCTCAAAATAAGCAGTCCTGTTTTGCCACTGTCATCAAG
TGTCAGGAGGGAAGCAGTTCTCTGGCCAACAGCCCTTCTG
AGGTCTCATTAACTCCCACTGAGAACACAGACAACGCTGC
TGACTCCAGTACAGCTGCTAAGAGGAGGAGGTGGATCCTG
CACTGCCTCCAGACCGCAATCCACATCGTCCAGGTCACCC
TGGGCTACATGCTGATGCTCTGCGTCATGTCCTACAACAT
CTGGATCTTCCTGGGCGTCATCACGGGCTCCGTCTTGGGA
TACTTTGTGGCTTTTCCTCTCCTGAATCACACTTGAGAAG
AATTAAAACAGCCGGAAAATGTTAATCTCCAAACACTGAG
GACTCAAGAGCAACAAGAAAGGTTTTAGATTTTTGCCATG
CCAGGTTTGTGAGCTCATGATATTGAGATACGACATCTAA
ACGTTGTTTTTAAAGATGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations