Transcript

slc31a2-202

ID
ZDB-TSCRIPT-091110-1067
Name
slc31a2-202
Previous Names
  • slc31a2-001
  • ch211-282j22.4-001
  • dkey-11o15.9-001
  • ottdart00000043771
  • si:ch211-282j22.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043771 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043771|OTTDARG00000031447|ZDB-GENE-030925-25 slc31a2|OTTDARP00000034694 CH211-282J22.4-001 LG_none FP085417.10,BX649400.9 Danio rerio protein_coding NOVEL, 1459 bp
GCACTCGTTTTGTTTCGGGCAGAGCGCCTGTCAGCTGTTG
AGCTACTGTATAATGACAGATAAAATGTTTGCTGATGGGC
AGTTGCTAATGAAAGTTGCATGTTTGTCATAAGGGACGTT
TCGTCTGTGTTAAATTCCCTCGAACTCGTCTTTTGAGGAC
TTTTAAGAAGCGAGTTCATCATGAATATGTACTTTGAAGG
TTCCAGTAATGTCACGCTGTTGTTTAATTTCTGGAACGTG
CATGGACCTGCAGGGATGGTGCTGTCAGTGTTTGTAGTTC
TGCTACTCACAGTGGTGTACGAGCTTCTGAAAGTGTGGAA
AATCACCGTTGGGAAACAGAAGTCGTCCCCCAACACAAGT
CCCTCCACTGCAATGTCATTCTCTCAAAATAAGCAGTCCT
GTTTTGCCACTGTCATCAAGTGTCAGGAGGGAAGCAGTTC
TCTGGCCAACAGCCCTTCTGAGGTCTCATTAACTCCCACT
GAGAACACAGACAACGCTGCTGACTCCAGTACAGCTGCTA
AGAGGAGGAGGTGGATCCTGCACTGCCTCCAGACCGCAAT
CCACATCGTCCAGGTCACCCTGGGCTACATGCTGATGCTC
TGCGTCATGTCCTACAACATCTGGATCTTCCTGGGCGTCA
TCACGGGCTCCGTCTTGGGATACTTTGTGGCTTTTCCTCT
CCTGAATCACACTTGAGAAGAATTAAAACAGCCGGAAAAT
GTTAATCTCCAAACACTGAGGACTCAAGAGCAACAAGAAA
GGTTTTAGATTTTTGCCATGCCAGGTTTGTGAGCTCATGA
TATTGAGATACGACATCTAAACGTTGTTTTTAAAGATGAT
GCTCTTATTATTTGAAATCTGACAATAACCAGTTGTACAA
TTGGTTGAAAAGACTTTAAATGTATTTGAAAGCTCATTGT
GAACACATTATCTTACATTAAGATTGGTGTTGAACGTGAT
TTTAAATTTGAGGTCACATTGAACACGTAAAAACAGTTTT
AGATTTTGTGATATAAGTAACAAGCTAACTTTTCAGATAC
TCAAATGAATGTTTAGCTGCTGGCTGTTATTTTGGGAAAT
TGCATTGCATCACGTTTGATATTAGTGTCGCAGTAAACTT
CTTACATGACTTAACAGCAGGCGTACGCTTGTCATGCTGG
AAATGACTGCCGAATGTGGAACAAAAGCATTGGTTTAGAA
GAGAAATGCAAATCATGTGGCCTTAGTTAATGTTCAGCAG
GAACACAGAGACACTGAAACTAATTGACTGACCGAGAGAA
GAAACTGGAGACCTGCAATTCTCACCACAAGCATTTAAAT
GTGCTAGTCATAAAAATCACACACACACACACACGCACGC
ACGCACGCACACACACAGGTGTTTTTTGTTGGTTTGGTCT
CTACTGCAAGTGGTCATCATTTTAAAATGGTTTTATCAAA
TTAAATGATCTGGTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations