Transcript

cpb1-201

ID
ZDB-TSCRIPT-091110-1908
Name
cpb1-201
Previous Names
  • cpb1-002
  • dkey-29n19.2-001
  • ottdart00000044223
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044223 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044223|OTTDARG00000021316|ZDB-GENE-030131-1132 cpb1|OTTDARP00000035015 cpb1-002 LG_ AL935306.6 Danio rerio protein_coding KNOWN, 1328 bp
AAGGACTACACAGGTAAAATGAAGTTATTTTTGCTCTTGG
GATTGGTGGCAGTGGCTCTCTGTGAGCCAATCACATTTGT
GGGTGATAAGGTCCTCCAGCTGAAACCCATAAATGATGAA
CATGTGACCATCATCAGGGAACTGGGCGAGAAAATCAAGC
TGGATTTCTGGAAGCCTCGCAGTGCGGATCTTGTGAGCAT
CGACATGACTGTTGATATCCACGTTCCTGCAGCTCAGCTC
GCCATGGTCTCCACCATCCTACAGCAGAGCGACATGGAAG
TCAAGGTGATGATTGATAATCTTCAGGAGGCTGTGAAGGA
TCAATGACTGGGCAATCTCCATCAGCTCTGCCAACCCTGA
CCTGATCAGCAGGCAGTCGATCGGTAACACTTATGAGGGA
AGAACCATGCACCTTCTGAAGATTGGAAAGAATACAGGGT
CTAATAAGCCAGCAGTCTTCATGGACTGTGGTTTTCATGC
CAGAGAATGGATCACCCATGCTTTCTGCCAGTGGTTTGTT
AATGAGGCTGTGTCCACATATGGCAGTGATCCTGACATGA
CCAACCTTCTGGACAGAATGGACTTCTTTGTTCTGCCTGT
CTTCAACATTGATGGCTATGAATACACCTGGAACAGAGAC
AGAATGTGGAGAAAGACACGATCCAAGAACAGCGGCAGCA
GTTGTATCGGTACTGACCCCAACAGAAACTTCAATGCTGG
ATGGTGCACCGTTGGAGCTTCCAGCAACCCTTGCAGTGAC
ACCTATTGTGGAAGCAGTCCAGAATCTGAGATTGAGTCCA
AGAATTTGGCCAACTTCATCCGCACCAACAAGTCCGTCAT
CAAGGCCTACCTGACAGTCCACTCGTATTCCCAGCTGCTG
CTCTTCCCCTATTCCTACAAATATGACCTGGCTGCTCACC
ACTCAGAGCTGATGAGTGTTTCTCAGGGAGCTATTGCAGC
TCTGCGCAGCCTGTATGGAACCAAATACACTAGCGGCCCT
GGTGCTGCGACTATCTACCCTGCTGCTGGTGGCTCTGATG
ACTGGGCTTATGATCTGGGTGTGAAATACTCCTACACCTT
TGAGCTGCGTGATGAAGGCCGTTACGGTTTCCTGCTGCCC
GAGTCCCAGATCAAGCCTACTTGTGAGGAGACCATGCTGG
CTGTCAAATACATCGCCAACCACGTCCTCAACAACCTGTA
CTGAGAGGGAACCATCTGATAGAAAGATTATAAAACATGG
CTGTGCGTTATGTGACATACATTTACTGCACAATTGAAAA
ATAATCATGATCAGTAAAGTAATAAAACACAGATGTCTTT
TTGTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations