Transcript

cpb1-202

ID
ZDB-TSCRIPT-090929-9659
Name
cpb1-202
Previous Names
  • cpb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027072 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027072|OTTDARG00000021316|ZDB-GENE-030131-1132 cpb1|OTTDARP00000022189 cpb1-001 LG_ AL935306.6 Danio rerio protein_coding KNOWN, 2220 bp
GGAGGAGGTGGTCCCCGTGTGGGCCTTACTTTATAAAAGG
AGAACTGTGTGGAGAGAAGGACTACACAGGTAAAATGAAG
TTATTTTTGCTCTTGGGATTGGTGGCAGTGGCTCTCTGTG
AGCCAATCACATTTGTGGGTGATAAGGTCCTCCAGCTGAA
ACCCATAAATGATGAACATGTGACCATCATCAGGGAACTG
GGCGAGAAAATCAAGCTGGATTTCTGGAAGCCTCGCAGTG
CGGATCTTGTGAGCATCGACATGACTGTTGATATCCACGT
TCCTGCAGCTCAGCTCGCCATGGTCTCCACCATCCTACAG
CAGAGCGACATGGAAGTCAAGGTGATGATTGATAATCTTC
AGGAGGCTGTGAAGGGTCAGATGGACAACAGGAGTCCAAC
AAAGGGTCACGACTACACAAAGTACAACAGCTGGGCAACG
ATCAATGACTGGGCAATCTCCATCAGCTCTGCCAACCCTG
ACCTGATCAGCAGGCAGTCGATCGGTAACACTTATGAGGG
AAGAACCATGCACCTTCTGAAGATTGGAAAGAATACAGGG
TCTAATAAGCCAGCAGTCTTCATGGACTGTGGTTTTCATG
CCAGAGAATGGATCACCCATGCTTTCTGCCAGTGGTTTGT
TAATGAGGCTGTGTCCACATATGGCAGTGATCCTGACATG
ACCAACCTTCTGGACAGAATGGACTTCTTTGTTCTGCCTG
TCTTCAACATTGATGGCTATGAATACACCTGGAACAGAGA
CAGAATGTGGAGAAAGACACGATCCAAGAACAGCGGCAGC
AGTTGTATCGGTACTGACCCCAACAGAAACTTCAATGCTG
GATGGTGCACCGTTGGAGCTTCCAGCAACCCTTGCAGTGA
CACCTATTGTGGAAGCAGTCCAGAATCTGAGATTGAGTCC
AAGAATTTGGCCAACTTCATCCGCACCAACAAGTCCGTCA
TCAAGGCCTACCTGACAGTCCACTCGTATTCCCAGCTGCT
GCTCTTCCCCTATTCCTACAAATATGACCTGGCTGCTCAC
CACTCAGAGCTGATGAGTGTTTCTCAGGGAGCTATTGCAG
CTCTGCGCAGCCTGTATGGAACCAAATACACTAGCGGCCC
TGGTGCTGCGACTATCTACCCTGCTGCTGGTGGCTCTGAT
GACTGGGCTTATGATCTGGGTGTGAAATACTCCTACACCT
TTGAGCTGCGTGATGAAGGCCGTTACGGTTTCCTGCTGCC
CGAGTCCCAGATCAAGCCTACTTGTGAGGAGACCATGCTG
GCTGTCAAATACATCGCCAACCACGTCCTCAACAACCTGT
ACTGAGAGGGAACCATCTGATAGAAAGATTATAAAACATG
GCTGTGCGTTATGTGACATACATTTACTGCACAATTGAAA
AATAATCATGATCAGTAAAGTAATAAAACACAGATGTCTT
TTTGTTGAATATTATCTTATGGAAAGTACCCCAAACTTTT
TTTTTATTTTTATGGACACTTACATTTGATAAATATTTAA
TGTTATATGATATCACACCATTATACTGTAGGAATGCCCA
TTGAAGAACAAAATAAGTGTACTAAATAGCAATACCGATA
TATTGAAGACCAAACTAAACCACCTTTTTATGATCTGAAA
AAAGTCAGCACAGTGTAATTGGAAAATTGAAGACTTGAAG
ATCTAAATATCTGTGACTTAAAACAAATTAAAATTAGACA
GGTATGTGCTGCAGATTTGCCCTGTACCTACAAATAAAGC
GGTGTTTACAAAATAGTTTCCCCAAAAAAGAGTTTTAGGC
AAATCTGTCCACCCTTCAGAGTTACAAATGTTCTTATCAT
CCTATCCTGCTTGCATCTTCCTGTGGGTGCTACTGGATCT
TAGTCATCCTTTCTCAATGTTATTAATTTGTCAGTAAATG
TAAAAGATTGACAATTTTATTGCGGAGTACCCCAGGGCTC
GGTGTCCAGCCCATTTCTTTTTACTCTGTATTTACATACT
ACCCCCTAGGTCAGGGGTTCTCGGTCCTGTAGGTCCGGTG
TTTTAGCTCCAACCCCAATCAGACCTATTGATGATGAGTT
GAGGCAAAATGGAGCTAAAATTTGCAGGACACCGGGCCTC
AAGGACTGAGTTTGAGAACCCCTGCCCTAGGTGATATCAT
TGAGATGATTGTCTTGTAAAACTCATAAATATGCTTAATT
TTAAATTAAACCCACAGCCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations