header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1026
Transcript Name: znf532-203
Previous Names: znf532-002, ch211-238p8.13-001, ottdart00000043619

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043619 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043619|OTTDARG00000018943|ZDB-GENE-060531-40 znf532|OTTDARP00000034579 CH211-233A1.2-002 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 609 bp
GGATGACTCGTTTGGGGTGGACGCGGAAAGTTTAAAGCCT
CCTCCCAGGGTTTCTGCGTCAGGATCTGGGCAGGTTTTGC
TGTGCATGGCAGCAGCAAGAATCATGGCTGGCCTTCTTGT
CTTTGATATTTGCCTTTGCTGCCCTGCTGAGACGAAGAGC
CCTCACATCCAAGCTTTTAATTGAGACACAGCCCTTTCTT
ACAATAACCCACAGGTGTTAAGCTCATTTTCATGAGACCA
TGGGCGACATGAAAACCCCAGACTTTGATGATCTGCTTGC
GGCCTTTGATATTCCTGATATGGTTGACCCCAAGGCTGCC
ATTGAGTCTGGCCATGATGATCATGAGGGACAGCTCAAAC
ACAATGCCCACCATGAAGAGGACTCCCATGCCACCTCTGG
TCCAGATGTCGGGGTTAGTGTTATTGTTAAGAACGTTCGA
AATTTTGATGCCTCTGAACATCTTTCAGAGAAGGATGTTC
ATCCAACTGTCGGAAATGGATTGCGCAATGGATTCTTGCC
TGTGTCGCCCAACAACAGATACAGAAAAGAAAGTGACAAG
CTTCAAAAAGGTGAAATCCATGGGATGGCAGGAAATATCT
CCACATTCA

znf532 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript znf532-202 (1) 798
mRNA znf532-203 609
znf532-204 (1) 403
znf532-205 (1) 4371
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf532-203 Contained in:

OTHER znf532-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043619 (1)
  • Ensembl_Trans:ENSDART00000143257 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB913432 (1) 609 bp
    CITATIONS (2)