header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-295
Transcript Name: znf532-204
Previous Names: znf532-004, dkey-264m23.2-001, ottdart00000043621

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043621 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043621|OTTDARG00000018943|ZDB-GENE-060531-40 znf532|OTTDARP00000034581 CH211-233A1.2-004 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 403 bp
AGAGGAGAGAGTGACCTATAGAACTGAACCAGCAGGCTCA
TAGTGAAGGGAAAAAAAGCACACTCATACAGAATGGGGCC
TGGCTGGACTGACGTCTTGCATAAACCTTTCCACGAAGAT
TCCCGGTATTAGGGCCGAAGAGAAGCGGGGTGTTAAGCTC
ATTTTCATGAGACCATGGGCGACATGAAAACCCCAGACTT
TGATGATCTGCTTGCGGCCTTTGATATTCCTGATATGGTT
GACCCCAAGGCTGCCATTGAGTCTGGCCATGATGATCATG
AGGGACAGCTCAAACACAATGCCCACCATGAAGAGGACTC
CCATGCCACCTCTGGTCCAGATGTCGGGGTTAGTGTTATT
GTTAAGAACGTTCGAAATTTTGATGCCTCTGAACATCTTT
CAG

znf532 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript znf532-202 (1) 798
mRNA znf532-203 (1) 609
znf532-204 403
znf532-205 (1) 4371
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf532-204 Contained in:

OTHER znf532-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043621 (1)
  • Ensembl_Trans:ENSDART00000144460 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB772698 (1) 410 bp
    CITATIONS (2)