header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6344
Transcript Name: znf532-205
Previous Names: znf532-001, si:ch211-233a1.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023152 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023152|OTTDARG00000018943|ZDB-GENE-060531-40 znf532|OTTDARP00000019272 CH211-233A1.2-001 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 4371 bp
CAACTGGGTGGCTGCCATTCACACACACATACACGAGTAT
ACGATAACTCATGATGTTTCGAAACATGTCAACATCTTCA
TGCTGAAACAAATGCTAATTTAATTAGATGTTTGAGTATA
AAGTCCGTCCGTGATGATTGTAAGGAGCGTTTAGGCATCG
CCGCAGTGATTCATGGGTTTTGCTGTGCATGGCAGCAGCA
AGAATCATGGCTGGCCTTCTTGTCTTTGATATTTGCCTTT
GCTGCCCTGCTGAGACGAAGAGCCCTCACATCCAAGCTTT
TAATTGAGACACAGCCCTTTCTTACAATAACCCACAGGTG
TTAAGCTCATTTTCATGAGACCATGGGCGACATGAAAACC
CCAGACTTTGATGATCTGCTTGCGGCCTTTGATATTCCTG
ATATGGTTGACCCCAAGGCTGCCATTGAGTCTGGCCATGA
TGATCATGAGGGACAGCTCAAACACAATGCCCACCATGAA
GAGGACTCCCATGCCACCTCTGGTCCAGATGTCGGGGTTA
GTGTTATTGTTAAGAACGTTCGAAATTTTGATGCCTCTGA
ACATCTTTCAGAGAAGGATGTTCATCCAACTGTCGGAAAT
GGATTGCGCAATGGATTCTTGCCTGTGTCGCCCAACAACA
GATACAGAAAAGAAAGTGACAAGCTTCAAAAAGGTGAAAT
CCATGGGATGGCAGGAAATATCTCCACATTCAACCAGTTT
AGTCCAATCTCTAGTGCAGAGGAGTTTGATGATGATGACA
AGATTGAAGTAGATGACCCTGCAGACAAACAAAGTCATTT
ATCATTTAGGCCAAACCCTTTAACTGGTTCTGGTGCAAAG
ATGGAAGAGCCTCGTTCTCAACACATAAAAGCAGATTGTG
CATCTAGGCCGAGAACAAATGGCAACTGCCATAAGTTGAA
AGTTGAGAATGGCAGCACCAATGGAAAAGTGGGACATGCA
AAACTGCATGACTCTCAAAAACCAAGAAAAAACCAAGAGG
AACACTCAAAAGAAACCTCCACATCTCAAGAAGCAAAAGA
ACCTGCAGAACCAGTTATTGAGTTGAGTGTGACCAACTTT
TCCCAAGCAAAGGCCAAATCGTCTGCAAAGCTCTCATCCT
GCATTGCTGCAATTGCAGCACTGAGTGCAAAGAAAGCTAG
CACAGAAACAGTGCCTCCAGAATCTATTGCTACCACTCGA
GATTCACCCAGAGAGGCTAAAGAGATTCCAAAAGTTACAG
AAAAATCATTAGACCAGGAATCTGCTCTGGAGCTTAGCAG
GAAGGTGCTCACAAAACAACCTGATAGTCCTAGCAGTGTC
ACAAGTGAAAGCAGCAGCAAAGAGTCTCCTGCTTCTCCAG
CAGGATCCATACCAGTCATTCCCAAAGTTCGCATTAAAAC
GATCAAGACATCTTCAGGGCAGATCAAGAGGACAGTTACT
AGAGTCCTGCCTGAGTTTGATCCTGATGGCTTGAAGAAGG
GTGTTGATTCTTCATCCAATGTTGTGTCTTCTCTCCTGTC
CTCTTCAACCTCGCCTTCTGTTTTCTCTTCTCCCACCAGA
ACAACTTTGCCAACCACAGTAGTAGCAACTTCCGGAGGCT
CTGCCATTGAGGTAACTAAACAAATGACCATCAAACCTGT
GGCCACTGCCTTCTTACCTGTCTCAGCTGTTAAAACGGCA
GGGTCACAAGTGATAAACCTGAAACTTGCCAACAATACCA
CTGTAAAGGCCACTGTCATACCAGCGGCATCTGTTCAGAG
TGCCAGCAGTGCCATCCTTAAAGCTGCTAATGCCATTCAG
CAACAAACTGTCATGGTGCCTGCTTCCAGTCTAACAAACA
CCAAACTTGTGCCAAAGACTGTCCACTTAACCAACTTAAA
TCTCTTGCCTCAGAATCCATCATCGGCTGAGCTACACCAG
GCCCTGACCAAGCCTCAACAGCCCATCAAGCAAGCCCTGT
TGGCCCAACAGCAACAAAAGAAGGTGTCTCGGGTCCAGGT
CCTAACCAGTTCCCAGAGCTCAGTGGTGGAGGCCTTCAAT
AAAGTTTTGAGTAGCATTAATCCTGTCCCAGTTTATGTAC
CAAATCTAAGCCCTCCAACTTCAGCCTGTATATCGTTACC
ATCCCGTGGATATAAGTGCTTGGAATGTGGTGATTCCTTT
GCCCTGGAAAAAAGCCTCACTCAGCATTATGACCGTAGAA
GTGTCCGCATTGAGGTCACGTGCAACCACTGCACCAAAAA
TCTAGTCTTCTACAACAAGTGCAGCCTTCTATCACATGCT
AGGGGCCACAAAGACAAAGGTGTTGTAATGCAGTGTTCAC
ATCTCATACTAAAGCCAATTCCAGCTGACCAGATGATTCT
GGTCCCCTCTGTAACTTCCAGTGCTCCCACCTCTTCAGCT
AACCTTGGATCCTTGATAGCAGGGAGCCAAGGGAAGGGAA
ACTCAACCACAGTGATCTCCGCGCCCTCTTCTGCCCCAGT
TGTTGCTGCCATGCCTCTTGATAAGGATGCCTCCAGGGTC
TGCAGATCGAATCTGAAGTGCTTGGAATGTAATGAGACGT
TTCAGGAGGAGTCAGCTCTTGTAATGCACTACCAGCAGGC
TCCCGAGTCAAGTGGACAGAAAACCTGCACCATTTGCCAA
ATGCTGCTGCCAAACCAGTGTAGCTTTGCCTCCCATCAGC
GCATCCATCAGCACAAGTCTCCGTATATCTGCCCTGAATG
TGGAGCTATCTGTCGATCTGTCCATTTTCAATCCCATGTG
ACCAAAAACTGCCTGCACTACACACGCCGTGTGGGCTATC
GCTGTGTTCACTGTAGTGTCATCTTCGCCGATGTTGCCGC
TCTCAAGTCACACATTCAGGGATCTCACTGTGAAATCTTC
TACAAATGCCCCATCTGCCCCATGGCTTTTAAATCCGCCC
CTGGTGCACATTCCCATGCCTACACCCAGCATCCAGGAGT
CAAAATCGGAGAGCCTAAGCTGATCTACAAGTGTTCTATG
TGTGACACAGTTTTTACCCAGCAGACTTTGCTCTACACGC
ACTTTGACCAGCACATATCCAGTCAGAAAGTGTCTGTCTT
CAAGTGTCCAGACTGTTCGGTGCACTACGCCCAAAAGCAG
CTCATGTTGGATCATATTAAATCGATGCATGGCACCTTAA
AGACCATCGAGGGCCCTCCAAACCTGGGCATTAATCTTCC
TCTCAGCTCCAAACCTACTAATTCCCTGAGTCCCAATAAC
AACAGCAACAACAAGGAGAGCAGCTCCATCAGCAACCTGG
AGAAGGGAGAGAAGAAACCAGTGTCACCGACAAAGAAGAG
CAGTAATGGGACAGACATTCCCAAAAAACCACCTCCTTCA
ACCTCCTGCCCTGGCTGGAACTGCAGAGACTGTGACCGCT
TGTTCACACAGAGAGAAGTCTACATCTCGCACATGAAAAG
AGAGCATGGGAAGCAACTGAAAAAGCATCCATGTCGGCAG
TGTGAAAAGTCCTTCAGTTCCTCTCACAGCTTATGCAGAC
ACAACCGAATCAAACACAAGGGCCTACGGAAGGTCTACTC
ATGTCCACACTGTCCAGATCCAAGTCGAACCTTCACAAAA
AGACTGCTGTTAGAGAAACACATTCATTTAATGCACACCG
TTAAAGAGACCGAAGACAAGCTTCCAGCTGATTCCAGCAG
CAACGAAGCCACGGCGGAAAAAGAGCAGGTTCCCAGTCCT
AAAAGAAAGCTCCACTCTGAAGATGAAGACGCTGATGGCC
AAGAGGATGTGGAAGAACCCAAAGGAGACGTGACTTCCTG
TCAGCGGCCGAAGGGCTCGTCCCTACAACCTCTAAAGAAA
CTTAAGATCAACGTCTTCAAAACGCACAAATGCGCCGTGT
GCAGCTTCACCACTGAAGACATTGTGCGTTTTCATGAGCA
CATTCCCCAGCACAAGACTGACGTCTCGTCCTTCCAGTGC
CGCGAATGTGGCCTGTGCTACACCTCGCACCATTCGCTCT
CACGACACCTGTTCATCGTGCACAAGCTGAAAGAGCCGCA
GGGATTCGGGCGGCACAACGGGCAGCAGGAGAACACTCCA
AACCCTGAGGACAATGGTGGCATCCCGGACACTCAATGTA
AAGTATGTTCAAAGACGTTCGATACAGAGGGAGCCTTAAA
CACACACATGCGGACACACGGAATGGCCTTCATTAAGTCC
AAGCGGCTGAGCGCAGCTGAGAAGTGAGAACGGAGGTTGG
TTTACAACAAAGTACTTGTTTGTATATTGTACAGTCCCAA
GTCTGGTACAAAAGGTTGGGGTGTTTTGTGAAATGCAATA
GAATCAAGAATGTGTGAAGGCTGGATTAAACTTCTGCATT
GAGTGATCGTC

znf532 TRANSCRIPTS
Type Name Length (bp) Analysis
aberrant processed transcript znf532-202 (1) 798
mRNA znf532-203 (1) 609
znf532-204 (1) 403
znf532-205 4371
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf532-205 Contained in:

OTHER znf532-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023152 (1)
  • Ensembl_Trans:ENSDART00000146248 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG308645 (1) 545 bp
    GenBank:AL922513 (1) 530 bp
    GenBank:BG305105 (1) 504 bp
    GenBank:BG305099 (1) 417 bp
    CITATIONS (2)